Well, Gordon, go ahead. Slip into your suit now. : HalfLife
Well, Gordon, go ahead. Slip into your suit now. : HalfLife
Half Life: All about HEV Suit - Home - Valve Time
How do I change the hazard suit music? :: Half-Life
Hazardous Environment Suit/Quotes - Combine OverWiki, the
Enemies - Half-Life Wiki Guide - IGN
Half-Life - Game Script - PC - By wel - GameFAQs
HEV Suit Courses - XpCourse
HEV Suit | Half-Life Wiki | Fandom
Half-Life Cheats, Codes, and Secrets for PC - GameFAQs
Half-Life Cheats and Cheat Codes, PC
how to put on hazard suit half life
how to put on hazard suit half life - win
First Contact - Fourth Wave - Chapter 414
[first] [prev] [next] Undrat knew he wasn't the brightest neo-sapient in the galactic arm. None of his people would ever be known for hyper-intelligence or cleverness or ingenuity. They were not grand philosophers or intellectuals. They admired intelligence, admired cleverness, even though comprehending it beyond acknowledging it was largely beyond their capabilities. That did not mean his people were worthless. His people were the kind of people that slogged through history, their eyes on the goal, ever walking forward. In the long drawn out march of time they had discovered each thing slowly and progressed to the next even if it took centuries or millennia. It did not concern them that they were considered one of the less intelligent neo-sapience species, they knew what was important. Hard work. Perseverance. Endurance. For over fifty million years they had been one of the Neo-Sapient Species watched over by the Unified Council. Their home-world had been forgotten as they spread out among the Lanaktallan worlds. They were largely uninterested in colonies or expanding their race. They were content to enjoy the finer things in life. A job well done. A difficult and lengthy problem that the solution was perseverance being accomplished. Enduring whatever had to be endured. Over the aeons Undrat's people had always worked for the Lanaktallan. They were proudest of the fact that they were often moved by the tens of thousands to a new colony to provide the manual labor that a robot had not yet been programmed and fashioned to do. They had been part of the Unified Council for so long that most of the other species viewed them more as furniture or a standard issue part of anything that required labor. Undrat's people were robust. Their thick skin let them endure harsh solar emissions, their thick bones and heavy muscles let them handle work on planets up to 1.6G, more than twice the preferred gravity of the rest of the Unified Council species. Their internal organs allowed them to eat and flourish on bare nutripaste without even most of the additives that the majority of races required. They could eat rudimentary crops and usually even local food species with no difficulties. They healed quickly, even from injuries that would kill most of the Near-Civilized and Civilized Species. But they weren't the brightest or sharpest. Undrat had worked in a warehouse when the humans came. He and his men had watched the humans land. Had seen them and had admired their form, much like their own. Bipedal, two arms, moving with power even if they didn't always move with grace. He had largely ignored them, preferring to keep with his own work, which was carrying boxes and crates, running grav-dollies, and doing other hard jobs. His muscles were thick and solid, his endurance deep and rapidly recovering. He could work a whole nine hours and after fifteen hours of rest be ready to work again. He could lift his own body weight above his head. The Lanaktallan who was his Overseer had always praised Undrat and his fellow workers. After all, the Tukna'rn people were the backs the colony had been founded on. He was valuable property of the Fu'uku'ugu'utmien Industrial Conglomerate, with bar codes down his arms, across his back, chest and forehead, and across the back of his neck that he had been born with, the bar codes tattooed into his very gene code. If he had ever been curious enough to look he would have found that he and every one of his fellow Tukna'rn were more valuable to the Conglomerate than a fork lift. He would have just nodded, not really understanding why it should be surprising. He could work on any surface he could stand on, could work in different gravities, in different weather, with different cargos, without the need for programming or expensive mechanical maintenance. Of course he was more valuable. He could be put in cryosleep to go to the next world and virtually ignored for centuries if need be. The Terrans, the humans, had arrived and then came the great roars of THERE IS ONLY ENOUGH FOR ONE which made no sense to Undrat. Did not the dining facility have enough for everyone to eat? Was there not enough work to go around? Did not the Fu'uku'ugu'utmien Conglomerate not own all the resources of the planet and the people upon it? The reply of THEN DIE ALONE! made no sense to Undrat either. He could not imagine being alone for long. Tukna'rn and every other species capable of thinking were always in groups. Before he could be disturbed by having to contemplate the roars the sirens had gone off. Undrat had been sent into a shelter beneath one of the great warehouses. He and his fellow Tukna'rn sat patiently, eating and sleeping and everything else according to the computerized schedule. At time the floor shook and faint vibrations could be felt. Eventually the roar of THERE IS ONLY ENOUGH FOR ONE! had ceased. The shelter had sounded the 'all clear' and Undrat and his fellow Tukna'rn had been allowed back onto the surface of the planet. They had emerged, blinking at the harsh light that somehow penetrated the thick cloud cover. Their skin flushed a deep bluish-green in response, reacting to the increased radiation from the sun and the clouds. The Overseers had gone. Fled. Left. The Overseer in charge of Undrat and his fellow Tukna'rn workers was confused and angry. He approached the Terrans and whatever it was that the Terrans told the Overseer seemed to anger the Overseer more. Undrat himself heard the Overseer tell the Terrans that the Tukna'rn people were valuable assets, extremely valuable property of the Fu'uku'ugu'utmien Conglomerate and that he could not believe that the Conglomerate had abandoned them. Then the Conglomerate had returned with the forces that kept unruly colonists and workers in line. MilSec, CorpSec, and the fabled Executor Security Forces arrived in ships. Undrat had heard the Overseer tell the Terrans that of course the forces coming in weren't hostile, they were just there to protect valuable conglomerate property. Then the alarms sounded and the shocked and distressed looking Overseer led Undrat and his fellow Tukna'rn workers into the shelter again. Strangely enough, for reasons that Undrat did not know and did not think to ask, even more workers were led into the shelters by the Overseer. Many different species, some of whom even did the more intellectually demanding jobs of monitoring computers and other important systems. The Undrat simply sat in the shelters and waited. They counselled the other species not to complain, after all, there was food, air, water, and enough room to sit and even exercise facilities to maintain one's strength and endurance. Again, there was the rumblings and vibrations. The Overseer seemed extremely concerned, often wringing all four hands as he sat in the Facility Overseer's office. At one time Undrat himself saw something strange. The Overseer was talking to a hologram of another Overseer, who was obviously giving the Overseer orders. The Overseer suddenly picked up a chair that the Tukna'rn used when sitting in the Overseer's office and smashed the holotank with it. Three sleep shifts later the elevator came down and a squad of armored Overseers with "EXEC-SEC" written on them exited. They asked for the way to the Overseer's office. Undrat was tasked to show them. Undrat knew his people were not considered very intelligent and that he was an average Tukna'rn. But 'within standard species median' did not mean 'stupid.' He heard the Executor Overseer sneer about how Undrat and his people were 'lounging in such opulence and safety' and how 'they would be better used to clog the guns of the Terrans' rather than 'inhabiting a shelter better put to use by their betters'. His people were incurious not unintelligent. Undrat did not like what they were saying. His people were not animals. They were not wastes of resources. They were valuable and coveted property of the conglomerate and his Overseer was proud of them and admired by his peers for overseeing such industrious properties. When he got to the Overseer's office he was ordered to stand there, as if he was a robot. That did not bother him, he was used to short commands. The Executors ordered the Overseer to 'evict the neo-sapients so they could be armed to force the Terrans to fight them' and the Overseer protested. Undrat did not care about the argument at first. It was between beings who far outranked him and usually gave orders. But one statement got his attention. The ExecSec commander said it, pointing at the Overseer. "Kill this fool." Undrat reached out as the ExecSec officer drew his pistol, put his hands to either side of the Lanaktallan's torso, and twisted as he squeezed. Ribs crunched and the spine crackled as Undrat twisted the Lanaktallan's torso and bent it to the side. The other Tukna'rn did the same. Undrat's father, Ildrut, brought both fists down on the armored flank-spine of the one next to him, breaking the Lanaktallan in half. The Overseer merely stood and watched. Neural pistols went off and neural bolts thudded into the Tukna'rn, who felt them as a slight burning tingle where they hit and raised welts like they had been bitten by a particularly aggressive insect. A plasma pistol was fired twice, catching the paper clothing on fire but only causing the skin of the Tukna'rn to darken and painful burns on the first two layers of skin to happen. Then it was over. The Overseer stood there and nodded slowly. "You are loyal and valuable property," he said softly. "You did not betray the Conglomerate, the Conglomerate has betrayed you and every being in this shelter." The Overseer looked up from the bodies of the dead Lanaktallan, killed by heavy strikes of blunt fists and the pressure of the Tukna'rn grip. "Gather their weapons. Any who come down the elevator are to be killed until further notice," the Overseer said. But no more came down. Finally Undrat, who went everywhere with the Overseer, even slept in the same room as him, always carrying a riot shield and a heavy plasma rifle, saw the Overseer talk to one of the Terran lemurs on his vid-display. It was nearly a month later when the Overseer stated that he, and a handpicked group, would ride the elevator to the surface and speak to the Terrans. Undrat rode the elevator silently, holding onto the rifle. If the Terrans attempted to harm the Overseer, then he would kill them. Unlike the Tukna'rn, they would be as fragile as everyone else in a universe built to challenge even the Tukna'rn people. IF a fist did not do it, then he had a plasma rifle. He would not let the Overseer, who had shepherded and cared for the Tukna'rn since the time of Undrat's father's father's father's father's time, to come to harm. The clouds were low and heavy. The air smelled of burnt plants and like a greenhouse that had caught on fire. The air was heavy with soot and ash and lightning ripped at the clouds and the ground in equal measure. The Overseer had been wise to order everyone into hazardous environment suits. The world did not look as it had. Undrat looked around him. It looked as if a forest had grown where the tarmac of the great warehouse complex had once been, and had then been burnt away to leave behind sticky black ash. There was a heavy vehicle present. A large tracked vehicle, with a heavy cannon on it. The back was open, a ramp leading from the interior of the vehicle to the ground. Six bipeds with two arms walked down the ramp, all of them in some kind of black armor. Undrat could tell they were Terrans. They moved like the Tukna'rn people. With strength and power, even though they were taller and thus more slender. He nodded to himself that they all had weapons, after all, the Overseer had stated that the Conglomerate was fighting the Terrans over the Tukna'rn and other neo-sapients on the planet. Of course they were. The Tukna'rn were valuable property. Two of the six Terrans were carrying something fascinating to Undrat. They worse what looked like a kind of loading frame that Undrat had been trained to use when the object to be loaded was too much for even his strength. The frame was also attached to a heavy looking gun with a barrel as thick as Undrat's arm, the bullets leading into the gun were bigger than Undrat's fingers. It even had a small screen angled for the Terran to be able to look at it. A datacable went from the gun to the armored arm of the Terran. While the Terrans and the Overseer spoke, Undrat stared at the large gun. Curiosity, finally stirred to life by the entire situation, tickled at him. A strange feeling, but one that urged him to ask a single question instead of just mutely staring. "Is it heavy?" Undrat asked, speaking without first being asked a question. He was not addressing anyone of rank, he knew that. The Overseer was talking with the two who obviously had ranking. There were merely the two with the big guns and two others with heavy looking rifles that looked almost unfinished. The Terran looked at him, its face hidden by the black front of his helmet. It hefted the big gun. "It's pretty heavy." "How much does it weigh?" Undrat asked, curious as to how much a Terran could carry. "Ninety-two kilograms outside the man pack frame," the Terran said. "Total weight with the gunner's man-pack frame is one-hundred-twenty kilograms." Undrat's datalink, which helped him with things he was slow to do, told him how much it weighed, which was as much as he weighed. "Is it effective?" Undrat asked. The Terran gave a nod. "Light and medium armored fighting vehicles don't stand a chance. If a tank gives me too long, I'll rip it apart. The clankers and the dwellerspawn don't stand a chance." "Then it is good," Undrat said. falling silent. He admired the gun's lines, how lethal it looked. If he had that, he could keep anyone from harming the Overseer, the Tukna'rn people, or the other neo-sapients in the shelter. The Overseer had stopped talking, turning to look at him. Undrat pointed at the heavy gun and the Terran carrying it. "May I look at it more closely, Overseer?" Undrat asked. "If it does not bother the Terran, you have my permission loyal one," the Overseer said. He turned back to the Terran. "They are a good people and I do not allow them to come to harm. They are loyal, work hard, and ask for little in return but what they need to survive." "Answer his questions, Corporal," the Terran said. "Thank you for indulging him. Curiosity from his people is not common," the Overseer said. "They are slow to act unless ordered, but ultimately a gentle and trustworthy people." Undrat put the rest of what the Overseer was saying out of his mind as he slowly moved over to the Terran. One always moved slowly and obviously when approaching a stranger. "Have you had it long?" Undrat asked. "This particular one? About a month or so," the Terran said. "Command ordered at least one heavy gunner per squad once the Dwellerspawn started spawning heavy units in greater numbers." Undrat looked around. The vegetation looked weird to him and he realized he never really paid too much attention to the plants unless he was tending to a greenhouse or field of crops. "What are Dwellerspawn?" he asked. "Bioweapons from outer space," the Terran said. "They landed a month ago, we had to use atomic and biowarfare to counter them." "Oh," Undrat said. "Have you been in the shelter the entire time?" the Terran asked. "Yes," Undrat said, still staring at the weapon. He could see how it operated, although he was not sure about the function of the large orbs attached to the back of each of the ammunition boxes. Perhaps more ammunition? But why store it in a round object when a rectangular box would be more efficient? "How long?" the Terran asked. "Five hundred twenty-three sleep cycles," Undrat said. "We will have to go to half rations soon." The Terran nodded. After a while the Overseer turned around and made a motion at the Tukna'rn. "Follow. We must prepare for something." Undrat was slightly disappointed to leave the interesting looking weapon behind, but he followed the Overseer. They moved to one of the cargo loading areas for the shelter and the Overseer brought up the elevator. He ordered the Tunka'rn to rest and they waited. After some time the Overseer waved at Undrat and his cousin Akdru to follow. They moved over to the heavy door and opened it. Heavy blocky looking vehicles towing a heavy trailer were backed up to the door. The Overseer and the two Tukna'rn used hand motions to guide the three trucks as they backed up. When they reached a point halfway to the cargo elevator they stopped. Terrans got out and moved to the back, lowering the ramps in the back. Inside were boxes marked as food, medicine, clothing, toys, blankets, entertainment, and survival parts. The boxes were thick heavy metal, the kind Undrat had only previously seen on spaceships. One of the Terrans told the Overseer that he could have the boxes sterilized by fire or UV light, it was safe for the contents. The Tukna'rn worked without complaint alongside the Terrans to stack the contents of the trucks onto the elevator. Once it was fully loaded, the Overseer and Undrat's father rode it down. It was back in half an hour and Undrat was proud of his fellow Tukna'rn in the shelters for unloading the elevator so quickly. It went on, until finally the Overseer told the Terrans that the shelter's stocks were full again. Undrat was glad. He was tired now but did not want to show it in front of the Terrans. When he rode the elevator down with the last load of supplies, the Overseer told them all how he was proud of them, how they had done their people, and all the people in the shelter, proud that day. When asked how much longer that the people must stay in the shelter, the Overseer startled them all. "Until the Terrans say it is safe. The mad lemurs of Terra fight against the planet itself as the planet was corrupted by something vile from outer space," the Overseer said. "They are winning, but it is slow. We will all be safer in the shelter." "This is our home. Should we not fight beside the lemurs?" Undrat asked. The Overseer looked at him. "I am proud of your willingness to fight next to the lemurs, but no, you are untrained in combat. I will not waste your life." Undrat felt pleasure in the fact that the Overseer still considered him valuable. So Undrat stayed in the shelter. Helping maintain it, waiting patiently for the Terrans to say it was all clear. Less than a hundred sleep cycles passed before he was allowed to leave the shelter. The habitation where he had lived was gone, a pile of scorched rubble now overgrown with grass and moss. The dining facility was little more than crumbled plascrete. The vast warehouses were flattened, the tarmac reduced to thick soil. The Overseer led them to a place with thick walls. For almost a week he simply waited to be told what to do. He sat on his bunk for most days, watching the colorful programs on the vidslate he had been given, the cloth one piece clothing as comfortable as the boots. After that the Overseer told them that they would help the Terrans. He carried boxes, moved machinery, helped the Terrans as they kept "Refugee City Tau" working and providing comfort for everyone. One day the Overseer came to Undrat's room that he shared with three others. The Overseer sent the other three out and sat down on a chair, folding his arms. "Worker Undrat, while we were in the shelters you expressed a desire to fight next to the mad lemurs of Terra," the Overseer said. "I did," Undrat said after a moment. It took him a moment to remember, but he remembered it with perfect clarity. "Is that still true?" the Overseer asked. Undrat sat and thought about it. The Overseer waiting patiently. Finally Undrat looked at the Overseer. "It is." The Overseer nodded. "The Terran Confederate Military Forces are recruiting neo-sapients like your people. You are a good solid dependable being and a hard worker. I will be pleased to refer your name to their recruiters." "Thank you, Overseer," Undrat said, and meant it. The Overseer left. Two days later the Terrans came and got him. They had him take tests. Written, verbal, video. Tests of logic and math and spelling and problem solving. He answered the questions one by one if he could, if he could not, he simply moved to the next one once he realized he could not answer it. After that came the physical tests. Then tests regarding his emotional and psychological state. Three days later the Overseer informed him that he was accepted into the Terran military and that he was to go and choose one of the many jobs he had tested for. The Overseer urged him to be diligent in his studies when the Terrans trained him for his new job. Undrat agreed. A day later the Overseer came to see him off as the Terrans loaded him and others into a heavy vehicle to take them to Camp Alpha for training. A year later, Undrat went to see the Overseer in his new uniform. The Overseer expressed pleasure in seeing him and expressed pride in Undrat at graduating from the difficult Terran military training. He told the Overseer that he was a "Heavy Weapon Specialist" in the Terran Army now. The Overseer urged him to be diligent and attentive to training and his duties, as the Overseer was in ensuring that the neo-sapients, the people, under his care received the highest level of comfort and necessities he could. Another year passed. Undrat trained hard, mindful of the Overseer's words. He often wrote to his family, and the Overseer, about his training. He learned how to use many different weapons, from a simple magnetic acceleration pistol to the massive 155mm Hellbore crew served self-propelled gun. He learned to operate weapons from the doors of strikers, mounted on vehicles, or just plopped into the dirt. He learned how to call for close air support, for artillery, for orbital bombardment, for medical dustoffs. The Overseer wrote back, praising Undrat for his diligence. It had been two years to the day that Undrat had joined the Terran military when it happened. The sirens went off again. This time, the words from beyond were different. YOU BELONG TO US [first] [prev] [next]
How I got a (not really an) HOA disbanded - and destroyed a bitchy "President of the HOA" in the process. Warning: LONG ASS READ! - So long in fact, I had to split it into two parts! This is part 5-8
I was invited by one of the mods to share this here as a mega thread, so here goes... Edit - apparently this saga was so long that I had to split it into two parts. This is part 5-8. Well, apparently I need to put this in here. I do not give consent for my posts to be read/interpreted/posted to any monetized or ad-supported platform. Examples include YouTube or other platforms. Short version: If you make money off reading someone else's posts, I do not give consent for you to make money off of my posts. Part 5: IRS agents arrived bright and early yesterday morning at the Harpy's house. Including two from the IRS's Criminal Investigation Division. These are people with arrest power, by the way. And yeah, that's important later in the day. When I left for work Friday morning, the two IRS-CID agents were walking up to the Harpy's house. I texted my neighbor and friend who lives with a line of sight to her house, and he started sending me updates throughout the day. After the initial pair of agents arrived, another SUV arrived with several more agents. These were apparently there to collect evidence. Now, I need to briefly back up a few months before the psycho's world started to come crashing down. I had noticed a brand new Mercedes SUV driving around the neighborhood, but really didn't think anything of it. Never paid attention to who was driving it, and really couldn't care. Well, it turns out that before the excrement hit the rotating wind vectoring device, she was living high on the hog, and went out and bought herself a brand new shiny SUV. Among all of the evidence gathered Friday, they were looking pretty hard at that SUV. According to my friend, several pictures were taken, clipboards consulted, and a lot of looking at the area of the windshield where one would find the VIN. Around mid-day, the agents that didn't have "Special Agent" on their jackets began hauling out boxes sealed with red tape to their SUV. Several boxes. As well as at least one computer tower, and he thinks a laptop as well. I thought that my day was made. I really did. But Friday evening, my day got oh-so-much better. My friend came over and told me he had something to show me. He pulled out his phone, and gave me an absolute shit-eating grin. He made me wait for it. It was worth it. Dear readers, I got to watch video that my friend shot from his living room window, of the Harpy. Lil' miss President of the Not-Really-an-HOA. Oh, and an absolute bitch to boot, I got to see video of her doing the perp walk. I got to watch her be marched, obviously ranting and yelling, and stuffed into the back of a Federal Law Enforcement SUV. Word spread fast through the neighborhood. The scuttlebutt is mostly along the lines of "Interfering with the duties of a Federal Agent". Unsurprisingly, she was released on either bond or recognizance this morning. But she got to spend a night in jail. And she's managed to dig her legal hole just that much deeper. And there was just one last bit of schadenfreude this afternoon. I was out working in my backyard, and from my yard, I can see the side of her house. So I'm out there, and a flatbed tow truck comes up the street. Didn't think much of it, until I glanced over again, and happen to see it stopped in front of the Harpy's house. With a county Sheriff's Office cruiser parked there. (Guess they were helping out the IRS). I say that because that flatbed loaded up that brand new, not even a year old Mercedes SUV. With the Sheriff's deputy standing there the whole time. She was *not* allowed to remove any personal belongings from the SUV. She was not allowed within 10 yards of it, or of the tow truck, or the tow driver. As the driver was turning around to head back out of the neighborhood, I could see that she was on her phone. And clear as day, I heard her ask/shout "WHAT DO YOU MEAN, EVIDENCE!!!" My house is about half a block from hers. As her shiny SUV was towed away, it drove past my yard. She was watching it drive away, and then saw me in my yard. I couldn't help myself. I smiled, and waved. She flipped me off, turned on her heel, and stomped away. I've had a permanent grin the rest of the day. PART 6: Ladies and Gentlemen, this has been one helluva ride. But I think I may have won. Finally. As of last weekend, the Harpy's house has a "For Sale By Owner" sign in front of it. I wanted to wait and make as comprehensive update as I could. This morning, I got the call I was waiting for from my lawyer (although much more quickly than I was expecting this to all end.). As I mentioned in the comments in part 5, the Harpy decided to sue me. Tortious interference with business relationship. Tortious interference with contractual relationship. Intentional infliction of emotional harm. Loss of consortium (apparently this whole mess falling down around her ears caused her husband to divorce her). A couple of other things, but those were the high points. So this psycho decides to sue us for just over $100,000.... Not sure where she came up with that number exactly, but it was enough to cause my eyebrows to raise just a little bit. After my initial panic, I read through the complaint thoroughly. And realized that she had absolutely no evidence. Just a bunch of conjecture and assumption. She was guessing that I was the one who had initially mailed out the letter that revealed the sham HOA. And based the entire lawsuit on that guess. But she had absolutely no proof. Ok. Lawyering up time. I have a pre-paid legal service through my work, so I got the initial consultation provided by that, and after reading through the actual filings and complaint, my attorney started to laugh, and then got a very malicious look on her face. I told her the entire story, told her about the reddit posts, she read through them and felt that while they could all be tied together into a cohesive picture, that all depended on having some kind of evidence to start with. Assuming the Harpy somehow caught wind of these posts, in her opinion there wasn't enough to even send a subpoena to reddit to get my e-mail address. Not that it would have gotten the Harpy much, since there's not really any obvious link between that particular e-mail address and my actual name. Again, lots of conjecture, but nothing that could be entered into evidence in court. Why the laughter and then malice? Simple. Our state has a particularly robust "anti-SLAPP" ordinance in place. For those not familiar with the term, "SLAPP" is a "stragetic lawsuit against public participation". You hear about those lawsuits meant to just keep people quiet? Yeah, that's a SLAPP lawsuit. Essentially it's trying to use the legal system to punish you for exercising your free speech rights. So my attorney explains this to me in great detail. The short version of it is, the way the law is written, Harpy and her attorney now need to prove that this is not a lawsuit that is meant to deter participation in a public venue. This is *really* hard to prove in this case. We're not sure what their plan was , maybe try for a quick settlement or something. I can pretty much guarantee that their plans did *not* include an attorney with a lot of experience in SLAPP litigation. It certainly didn't help that the case was assigned to a judge that my attorney had argued in front of before, and she knew that this judge did not take very kindly to people attempting to weaponize the legal system. I'm not familiar enough with the legal jargon and the finesse of "legalese", but my attorney read through the complaint muttering things like "amateur" and "idiot". It was painfully obvious (at least to her) that this attorney was not exactly... "experienced". This became all the more evident once we got to our first hearing. We went before the judge in late December, just before the court took a break for the holidays (at least for civil matters - this delayed further proceedings in our case until last week). During our first hearing, after her attorney (badly) made his opening statement, my attorney got up there. And she absolutely destroyed him. I'm going to have to get a copy of the transcript and study it because some of the verbal judo she used was just a masterpiece. She tore the entirety of their case apart in about 15 minutes. There was absolutely no evidence, there was no way at that point to obtain any evidence to bolster their case, and it is obvious that this lawsuit was the legal equivalent of throwing crap at the wall to see if anything stuck. Then came the coup de grace. "Your honor, we would like to file a counter suit under [relevant state ordinance]. This is clearly a "SLAPP" suit, based on [multitude of legal citations and references] that is intended to stifle my clients right to free speech under both the [state] constitution as well as the United States Constitution. Even if my client had made all the statements the plaintiff alleges, which we do not admit to, they would be protected speech based on [lots of case citations]. As such, we are serving notice of our intent to seek not only attorney's fees and compensatory damages for my client's time lost from work, but also punitive damages under [multiple case citations]." (This is not an exact quote, I may update it if I get a copy of the court transcripts.) As soon as she mentioned that specific state ordinance, Harpy's attorney started to look a little nervous. But it was nothing compared to the look on the Harpy's face when my attorney mentioned the counter-suit. Panic probably covers that best. We were standing outside the courtroom after submitting our discovery request, etc with the court clerk for the counter-suit. We saw the Harpy and her attorney at the far end of the hall, and she was obviously tearing into him, albeit quietly. But you could tell she was *pissed*. She saw me looking at them, grabbed him, and walked away. At this point, I had expected to wait at least a month, maybe even longer before we got our next hearing. The Harpy's attorney provided the documents we had asked for though, and so my attorney and I went over them one afternoon. At this point, we had not yet set an amount we were countersuing for, but my attorney was saying that about $10,000 was probably what we would end up at provided that they didn't drag the case out and increase the billable hours/lost time figure. We weren't looking to break her, but we wanted at a minimum attorney's fees and my lost work time. That was probably about $4k at that point all together. Add in a few thousand for punitive damages, and we came up to that figure. But after reviewing the discovery documents we realized that Harpy was most likely not only flat broke, but drowning in debt. Last week, my attorney got a phone call from her attorney. They were looking for a quick settlement. But now it was the other way around. They were hoping we would be content with a quick settlement, and were looking for what it would take to just make this all go away. They realized that with the anti-SLAPP motion we had them over a barrel, and that she had absolutely no proof that I was the one involved anyways. They knew they were hosed, so they had made a request to the judge to dismiss their lawsuit. But because we had hit them with the anti-SLAPP counter, they now had to convince us to drop our suit. My attorney talked it over with me, and we agreed to let it go strictly at costs incurred. At that point we had gotten up to about $5k. And my attorney wrote the settlement offer in such a way that the Harpy owes the money to the attorney directly, instead of making me pay her and then try to squeeze water from a stone get paid myself. Darn nice of her, I thought. I know I'm probably not going to see the money that's owed me for lost time, but I used vacation time for those days, so I'm not really out the money, just out the accrued vacation time. Would be nice to get some of that back in the form of money, but it's doubtful. Maybe in 10 years that judgement will finally get paid. Who knows. My attorney called me this morning. The judge approved the settlement. The case was dismissed with prejudice (one of the conditions of our settlement) meaning the Harpy can't ever try to come back at me again for it. Also a no contact order against her. Just for grins... Would love to get her arrested for violating that order, but she's still looking at the potential for time in the greybar hotel for her IRS shenanigans. So that makes me smile a bit. Now, back to the listing on her home. Since she still has some contacts in the real estate world, even though her home is a for sale by owner, she managed to get it listed in the regional MLS with her as the contact for the "listing agent". The interesting bit about that is that she's very obviously in dire financial straights. Refinances in our county show up as "sales" in the public title history for a home. So looking at when my wife and I refinanced our home, we can see how much the house was "sold" for as the refinance on sites like Zillow. So I looked at the history for her home. She refi'd it around the time of the settlement to the neighborhood for the original fraudulent "HOA" scheme for very close to Zillow's estimate of what the home was worth. So I'm guessing she cashed out most, if not all of her equity in the home to pay for that settlement. The house is currently being listed for about 10% higher than the current Zillow estimate (yeah, I know those are pretty darn unreliable) but the real interesting thing is on the MLS listing, there's a spot where you have to disclose whether it's a short sale or a Bank owned property. And sure 'nuff, under Short Sale? It says "YES". Let that sink in. She's trying to sell this house for about 10% more than it appears to be worth, and it's *still* less than what she owes the bank.. I think I'll wait until I get home tonight, and then make a quick phone call to the MLS folks and let them know she's no longer a licensed real estate agent and that her listing is a For Sale By Owner. PART 7 (TAZERS!): So with the Coronavirus fun and excitement that everyone has been having, most of the courts in our area have slowed way down. Criminal cases are still proceeding in some instances, but not all. Federal courts have been hit or miss, but things have been slowly grinding through. I hadn't really planned on any more updates until the legal proceedings were all wrapped up, but we had some excitement happen a few days ago that I thought this group might appreciate. We had put a few cameras around our place after a utility trailer was stolen, and they're set up to alert us when they detect motion inside our property line (roughly - the zones start between 2 and 10 feet inside our property line depending on the camera angle). So after getting the kiddos to bed, the Mrs. and I were settling in to watch a little TV when my phone pinged with a motion alert. I pull it up and, sure enough, that sure looks like little Ms. Harpy coming stumbling up our driveway. Camera is in black and white mode since it's after dark, so we can't be sure. So she gets to the front door and that camera has enough light to show color, and sure as hell, it's her. What the hell? If you remember in part 6, part of the settlement was a no-contact order against this psycho. I ask my wife to go get our copy of the order out of the filing cabinet, grab a pistol and holster out of the safe real quick (licensed, don't worry) and throw it on under my sweatshirt. I don't trust this psycho for one second, and I have no idea what the hell she's doing. I'm on the phone with 911 already, asking them to send the county sheriff since I have a no contact order and the subject of that order is now on my front porch loudly banging on my door. Now, I admit that I made a mistake here. I did not want her to wake up my girls, so I put the 911 dispatcher on speaker, put the phone in my front pocket, and opened the door. Told her to step off my porch. I should have just left the psycho pounding on the door until the deputies arrived. Thankfully, my mistake did not bite me in the ass. And it did give me a front row seat for the shenanigans that were about to follow. I'm not sure exactly how much she drank. But she was beyond drunk. She was blasted. She reeked of booze as if she'd been marinating for a couple of days. Maybe longer. And of course, being that drunk, she was loud. I ask her to step away from my house some more so we can talk. Well, I talk, she yells. Basically what it boiled down to is (translated from drunk) that I ruined her life, that I'm the reason she's losing her house, I'm the reason she's going to jail (she didn't know it, but that was foreshadowing), I'm the reason the IRS is on her, that she lost her marriage, her career, her car, everything. This drunk soliloquy took over 7 minutes according to my cameras. She caps it off with "and maybe I should just kill myself right here right now and maybe you'd be happy with that too!". Well, crap. I'm now worried that she's got a knife, or some other weapon. I *really* don't want to have to draw on her, or worse. But I'm hearing the deputies coming (they stepped up their response to lights and sirens when she threatened to kill herself). So I know they're close, and I'm trying to verbally de-escalate her. Basically just trying to stall and let them come deal with her. I've backed up several more feet to open distance between us and am just hoping the deputies get here soon. All the time I've got an open line with 911 still on speaker phone. She continues her drunken rambling until the deputies show up about a minute later, mostly about how it's just "aaaaaaaall my fault". But now her drunk and belligerent escalates up a notch or 5, as she's realized that I must have called the deputies. She starts cussing at me, at them, at life in general. It's a pretty spectacular drunken raving. Kinda made me wish my cameras recorded audio. They are trying to get her attention, they're trying to get her to cooperate with their commands, and I'm backing away from her, telling her to talk to them. Well, pretty quick they realize she's gonna be one of *those* cases. So one of them draws their tazer and starts giving more... Forceful commands. Well, apparently little miss President of the Not-really-an-HOA really doesn't like being talked to in that tone. Especially not when she's drunk. So she turns to the deputies and starts giving them a piece of her mind. They're ordering her to put her hands up, etc, and she decides that she really wants to get closer to them to yell at them some more. Two steps. Two steps, and then I hear the oh so distinctive "POPtactactactactactactactactac" of a tazer being deployed. Stiff as a board, her momentum proceeds to topple her forwards and she faceplants right into my front lawn. Then she's at the bottom of I'd guess a 350+ lb pile of law enforcement and their assorted gear while they cuff her. She's wailing, crying, and I'm just in shock at how crazy this night has gone. Eventually she's stuffed into the back of one of their patrol cars and they come talk to me to figure out just what the hell was going on. By this point my wife has handed me our copy of the no contact order, which I show them and explain (briefly) what all has gone on that has led up to this point. The deputies go and try to talk to her, but she's just blabbering and crying now. Something else to realize is that with the COVID issues we're having, they're not really taking people to jail for more minor infractions, it's just a citation to appear at such and such date. So I figure they'll take her over But after running her through NCIC/LEDS, turns out that violating the no-contact order puts her in violation of the terms of her bail from when the IRS agents were there gathering evidence. Whoopsie. As of yesterday, she was still showing lodged in the county jail (our county has searchable lists of anyone in the jail), and on top of everything else, she's now been charged with violating a no-contact order and her bail has been revoked. Also from what the deputies were saying, on the off chance she is going to be released, since I'm the protected party on the no-contact order, I will be notified. I do believe she has picked that shovel back up and dug her hole that much deeper. PART 7b: Well, someone messaged me asking for an update - I'll keep it brief: She was released from jail approximately three weeks after this incident. We had a video conference with the judge, and she was not amused by Ms. Harpy's antics. Yes, my video recording of the incident (with the audio from the 911 call) were the prosecutors star witnesses. She made it abundantly clear that if it weren't for the current mess with COVID, she'd have kept Ms. Harpy in the county jail until she went to trial for the various charges. She did strengthen the protective order a bit. It was actually rather hilarious. She asked me exactly how far the Harpy's property line was from ours. A quick look at google maps and we had our answer "75 feet, your honor". The judge then told her that she was to come no closer than 75 feet from our property line in any instance, and that other than when she was at home, she was to maintain 300 feet from us at any given time. The Harpy had the audacity to whine "but that's the route I take to leave the neighborhood!" The judge asked her if there was another way out of the neighborhood. "Yes." "Then I suggest you take that route," the judge replied. It adds about 5 minutes to going anywhere from our area - she has to weave through a lot of residential side streets. Nothing earth-shattering, but certainly annoying. The house is still listed for sale by owner. Not surprising, since she's asking about 15% higher than similar houses have sold for in our neighborhood. She also has not dropped the price at all. I've seen some serious people in serious looking suits out at her place, so I suspect foreclosure may be coming down the pipe - again once this COVID mess is over. I haven't heard a peep regarding the federal charges she may be facing. I do know that to say the courts are moving at a glacial pace would be an understatement. I suspect that it may take a year or more for this part to process through. Plus the possibilities of appeals, etc. Ultimately, I am shocked at how this whole thing has snowballed. All over being bitchy to my wife. I suspect there's a lesson in there somewhere. :) PART 8 - THE END?: But first, the obligatory TL;DR: President of a fake HOA is a bitch to my wife. Gets sued, loses her husband, career, car, and house. She tries to sue me and loses. Decides to get drunk and belligerent, gets tazed. And now is convicted of multiple counts of fraud (misdemeanor and felony) plus a bunch more lawsuits filed. So a slightly longer summary is that when my wife and I bought our home, we were very specific in avoiding HOA's. After moving in, we met the "president of the HOA" behind our house. AT FIRST, she seemed nice enough, but little did we know the insanity that was going to come out of her. So we hired an arborist to take down a hazardous limb from a tree, and weren't able to move the wood onto our property the day of since he finished late and I was heading out of town the next day. The psychopath decided to freak out on my wife, until she browbeat her into moving these wood rounds (some weighing in excess of 100 lbs) by herself. They were stacked neatly, out of the way, and in no way an impediment to foot traffic. She claimed that the area that the rounds were stacked on was private property of the HOA (turns out it wasn't!) and that it needed to be moved immediately. Well, some time later, some hedges that were growing on the "HOA's private property" pushed over a section of our wooden fence. E-mailed her, and the short version of her reply was that it wasn't their property and wasn't their hedges so we were SOL on getting our fence fixed by them. Waitwhut? This kicked off a couple of weeks of calling a multitude of county departments to find out who actually owned that chunk of land. Eventually learn that it is actually county property as part of the right-of-way that was ceded to the county for a road. And the reason it took so long to figure this out was that there *was* no HOA registered with the county. So I sent an anonymous letter to everyone in the "HOA" with what I had found out. Cue everyone in the fake HOA suing her ass for fraud. Her husband, who was not in on the scam, promptly files for divorce - he wants absolutely no part in this. IRS and state revenue agency start crawling up her ass for back taxes. She was a real estate agent and principal broker. Those licenses were revoked by the state. She loses her job. House goes up for sale, it's listed for abut 15% higher than comps and it's still a short sale - so she's in deep trouble financially. She gets arrested for interfering with the duties of a federal agent when the IRS comes knockin - and they seize her brand new Mercedes SUV to boot. Tries to sue me, loses badly, and has to pay my costs and attorneys fees, and I file for a protective order because she's crazy. Gets drunk and belligerent, violates protective order. Gets tazed by the county mounties for her troubles. Jail again. Stronger restraining order. That all brings us to the beginning of this final update.... Due to COVID, courts in my state have been moving at a rather slow pace on civil cases, but criminal cases have resumed... And so recently I had the privilege of sitting in the witness box at our local courthouse, and got to explain to a judge and jury what this insane ride was (I wasn't one of the primary witnesses, I was more for the wrap up of the prosecutor's case. Most of the testimony came from not only her previous victims who lived in the fake HOA, but also other people she has defrauded over the years. It took three days just to get through all of the victims testimony. I was the final witness, and the prosecutor had already gotten the approval of the judge for my testimony, since while some of what I was going to testify to was second hand, it was corroborating the testimony of the actual victims, and really just wrapped the whole case up in a nice neat little package. So I got to sit there, and tell this whole saga, from start to finish. I don't think the jury even blinked. The defense attorney tried to object a couple of times about hearsay, etc, but he ended up overruled on most of them. The prosecutor then had to get his last jab in, "So Mr. AmbulanceDriver2, this whole house of cards that she had built up on fraud and deceit, what kicked out the card that caused it to all came down around her? "What it all boils down to is how she treated my wife that day. Had it not been her assertion of that strip of land being private property, I probably would never have done the digging that I did. But had she not been so rude to my wife, it's probable that I would have just let it go at that, and that I wouldn't have shared my findings with the entire neighborhood." I wasn't able to be in there for any of the other testimony since it could have tainted my testimony, but in the end she was found guilty of easily a half dozen misdemeanors and at least 10 felonies. I haven't been able to pull up the court records to get an exact count of which were which, but most of those were from new victims she had defrauded since the HOA scam fell apart. There were a couple of more technical violations of the law interspersed (I believe they were specifically relating to shenanigans she pulled as a real estate agent), but fraud is the bulk of what she was convicted of. Sentencing was rather anticlimactic, she got pinged for about 10 years, but talking to the prosecutor about it she will likely serve 5-6 years actually incarcerated. Her house is in foreclosure. Not sure when the auction is going to happen, but she had already moved out by the time it was officially foreclosed on. And she's still facing heat on the federal side. No idea what's going to be happening there. I'll probably find out if/when they request that I testify. I do want to address what some people have said in previous comments. That I'm taking this too far, that I'm taking too much glee in what's happened to her, that I'm a revenge bully. When I sent the letters to the neighborhood, I expected that the fake HOA would be disbanded, and not much more.I was somewhat surprised to hear about lawsuits, and I will admit to a certain degree of schadenfreude at seeing her knocked down a peg or three. But I had no idea how this was going to snowball. It's gotten to the point where I do somewhat feel bad for her. Like maybe I've taken this too far. But I have come to the realization that had she not been scamming people, none of this would have happened to her. While I may have been the one that kicked out the bottom card of that house of cards, I had no idea how massive this was. And so I save my pity for her victims. Most of them probably won't ever get back what they lost to her. Some did, early on. But that's a fraction of her victims. The rest? I highly doubt it. Last time I looked at the court records, she was named as defendant in at least a half a dozen lawsuits. I suspect that number has grown since then. I guess what it all boils down to is that if you're scamming people, don't piss off your neighbors. you never know what they might dig up.
I became the most powerful entity in the universe. What could go wrong? | Chapter 10
Hello everyone, Hope you're all having a wonderful day! I'd like thank you all for supporting this series, it really motivates me to write. With that said, hope you enjoy this chapter. Start from Chapter 1 | Previous Chapter | Next Chapter Chapter 10 - Is this the best day of my life? When you have an inseparable God virus in your body like I do, dreaming can go one of two ways. Either the virus reacts to the dream as it would react to conscious behavior, or it will be aware that its host is dreaming and attempt to interfere. I thought about it and found more than enough reasons to believe in the latter theory. But that raised another question — in what way will it interfere? A) Because dreams are a side effect to a natural brain activity during REM sleep, the virus will remove that side effect, preventing me from dreaming. B) The virus will try to communicate with me, or vice versa. C) The virus will give me lucid control over the dream, and since the virus is going to be involved, the experience will be somehow more exceptional than regular lucid dreaming. Analyzing these theories any further would be a waste of time, so I decided to put it in practice. But in the unlikely event that the virus is going to burn down the kingdom while I'm asleep, I knew I had to take measures to avoid that. So, I stopped by the inn after reverting the color of my hair and eyes. Yes, I mean ‘stopped by’ because I wasn’t going to do something dangerous like ‘sleeping’ in my own room, that would be crazy. You see, I had another destination in mind. It’s just that some preparations were in order before I headed there. The blanket we had on our bed was the first thing I took, securing a fairly comfortable surface to sleep on. I folded it and tucked it away in an empty leather bag. I also needed a rope, which I couldn’t find in the room. ‘I guess I’ll just buy one on the way,’ I said to myself and resumed packing. Next set of items were a blank notebook, a quill and a bottle of ink. Because, in case my dreams end up being completely ordinary, I wanted to take notes of what I could recollect after waking up; since dreams are normally easy to forget. For the last item I needed, I began preparing some UU enchantments. If you remember, UU enchantments are based on magnetically coded instructions electronically translated and converted into magic skills. Therefore, it doesn’t require the ‘enchanter’ to have an associated enchantment skill. Basically, I was manually encoding binary instructions into magnetic disks. Knock! Knock! “I have brought you tea, lord Zenith,” the innkeeper’s muffled voice came through the closed door. She apparently saw me enter the inn and prioritized on preparing me tea. “Come in,” I replied loud enough for her to hear. I remained occupied with coding, as she opened the door and walked up to the coffee table behind me. “Leave it here,” I said, referring to the study table by which I was working. Obediently, she brought it to my side and poured the tea from the kettle into the cup. “Lord Zenith, as you requested, the rumors about non-believers and ill-intended people being smitten by the one true God is being spread around. It was just as you predicted. We all received the news about the giant apple tree in the Kullu district, and now this whole city is talking about it in relation with the rumors.” “Very good,” I didn’t take my eyes away from the task I was doing. She set the tea cup and coaster off the tray and comfortably within my reach on the table. “I shall take your leave then,” she said and proceeded out. Before she got to the door, I called out to her. “Oh and could you bring me two sets of ropes? Maybe also something sharp to cut it with.” … I boarded a shared carriage to get to my destination. I wanted to board a private one, but they were all pre-booked. The shared carriage was not too bad though, especially because I paid the coachman for an extra seat. You see, with shared carriages, you have to wait until a certain amount of time or a certain number of passengers to occupy the seats before departure. When I boarded, the coachman needed one more person to board, so I offered, “I’ll pay for two people if we start now.” Unsurprisingly, money speaks louder than patience. On the ride, I continued working on encoding the enchantment instructions. Okay, I’ll admit that I couldn’t finish it at the inn like I thought I would, but in my defense, coding in raw binary language is a pain. So there I was, mashing buttons on a peculiar apparatus with every other passenger staring at me and it. The magnetic disk was inside a disk reader the size of a toaster, and it was connected to an input device with 3 main components; two for reading data and one for writing. On the left, there was a numeric keypad. This was to set the pointer on a specific memory location on the disk. Right above the keypad was an analogue screen with all the data readable in binary form. The device can read up to 8000 bits of data, the pointer starting from 0 to 7999, which is too much to fit on a still screen. So to its side, there was a rotator to scroll through the screen. Last but not least, on the right, there were two buttons representing ‘0’ and ‘1’ used to write data. Just to be clear, this apparatus was engineered fairly recently. When we initially made the UU enchantments, data was encoded manually by hand. After the demo, I designed this apparatus and Devon engineered it, making it easy thereon. Ignoring the curious stares of my co-passengers, I finished overwriting the old code with the new one. I ejected the disk from the disk reader, and pulled out the enchantment device out of my leather bag. Then I connected the disk to the input mechanism of it, and hoped for the best. Seventh time’s the charm. I snapped my fingers in the air and the sound was heard by everyone in the carriage. Following that, I released a little mana to be processed by the enchantment. And snapped my fingers again near the enchantment’s output. Voila! There was no sound this time. I didn’t hear it, and neither did the other confused passengers. My soundproofing enchantment was finally working. I put the device into my bag, and pulled out another disk to code the instructions for the second enchantment I needed. Fortunately, this one was simple. Because, what I needed was electrical insulation and I’ve already developed the binary code for that in the ‘lightning resistance’ enchantment that is among our line of products. It’s the equivalent of copy-pasting from stack overflow, except I’m the one who wrote the code in the first place. Anyway, I was done with all the preparations by the time I reached my destination, or rather close to it. I was dropped off about 3 kilometers away upon being stopped by government officials who prohibited entry past that point into the perimeter. Moreover, people who lived in that area were being evacuated on priority due to dangerous levels of electrical currents. Amidst this orderly confusion, I paid the coachman what I promised, and set my eyes back on the scene, specifically on the monster that was impossible to miss — the tree that penetrated the clouds and was generating several gigawatts of power every second. Imagine spotting a skyscraper from 3 kilometers away and it still manages to look breathtakingly massive, that pretty much sums up what I was seeing. Even as people were primarily focused on evacuation, there were still plenty who just stood and marveled at the tree. I overheard one of them, a lady, saying, “Did you hear? They are saying that this was an act of our one true God, smiting upon evildoers that were doing something bad in that place.” “Really? What were they doing?” asked the curious person to whom the lady gossiped. “I don’t know. But whatever it is, the city guards must be aware of it and are not telling us.” Surprisingly, the rumors have managed to spread so far in less than 10 hours; I suppose I underestimated my own followers. It looks like they are going to soon find out about the red mages who held captives for slave trading. And when they do… Needless to say, matters are moving in my favor. Anyway, on to dreaming. I moved away from the crowd, and found a secluded spot where I settled down. I made sure no city guards or civilians were in sight, and began focusing on developing a much needed skill at the moment — flight. There are plenty of ways to fly using magic. Despite that, not many were ideal for me in the current situation. For example, I can use some sort of gaseous ignition to initiate thrust, but that’s going to end up burning all the items I was carrying. As for flight methods that are not a fire hazard, I would need better mana control to perform. Not to worry though. I spent the whole carriage ride here, thinking of a solution. And the solution is simply brute force, by which I don’t mean jumping up, exerting force on the ground. That would be disastrous. I would be using pure mana as particles to carry me through the air. For anyone else, including the immortals, this would be a terrible method of transportation because it continuously consumes ridiculous amounts of mana. It's a good thing my mana pool is a bottomless pit. > Skillset: … 3D Space Navigation (Complexity - C) Based on its complexity, you could probably tell that this is a stupidly simple skill. I basically just need to input the 3-dimensional points in space (latitude, longitude, and altitude) and my mana will carry me to that point. Also, this was a really slow mode of transportation, so I activated my camouflage skill before performing it. I felt my feet lifting up along with my body, and the ground beneath me getting further away. This is the part where you would expect me to use a metaphor linking the ability to fly with freedom. Unfortunately, it was not a comfortable flight. You see, with the mana literally carrying me up, the force exerted on my body from below, including on the crotch region, felt nothing like freedom. I was waiting for the ride to be over. 15 uncomfortable minutes later, I reached the branches of the tree. I was defended against the electrical currents by the virus, as was my leather bag which I held closely to my chest. I landed, stepping on a huge branch. The width of that branch was as big as a sidewalk, and did I mention that the trunk of the tree is 15 meters wide? Looking down from where I stood, I saw thunderclouds, and past that, the humans were practically just a bunch of ants. I didn't waste much time admiring the view. I unpacked the enchantment tools and set them down between my legs. I pulled out the blanket and the rope and started crafting a hammock. The difficult thing was to ensure none of my items got knocked off by the altitude winds or lightning. Apart from that, things went not so badly. Although a bit crooked because I couldn’t find a perfectly straight branch, the hammock was set up with both the prepared enchantment attributed to it. Holding on to my bag which still had the book, quill, and ink bottle inside, I laid on the hammock and released my mana for the enchantments to work. Slowly, the noises of thunder faded away and electrical current was getting nowhere near me. I spent a solid 5 minutes consistently releasing my mana to make it an involuntary process as I fell asleep. For the purpose of lucid dreaming, I maintained a strong conscious awareness that I was going to be dreaming. You can try this out yourself. As long as your conscious is aware that you're in a dream, you'll have lucid control over it. Admittedly, it's easier said than done since it's not easy to maintain conscious awareness when you're in REM sleep. The trick is to slowly adapt to it and you'll eventually be able to do it consistently. The reason I'm telling you this is to make it clear that prior experiences with dreams significantly helps with lucid dreaming. With that being said, I had never experienced a dream before, at least as far as I was aware. I didn't have a clue about what a dream looks or feels like, I just knew the theory behind it. So unless the virus interferes, I should not be able to lucid dream. Now, what do you think happened? Did the virus interfere? Did it help me lucid dream? Yes, and yes. But, what I experienced was far beyond anything I predicted. To say it was extraordinary would be a laughable understatement. First thing I remember was me standing on the same tree branch, staring on to the planet’s horizon. This was my first experience with dreaming, and my conscious was not aware of it. It’s like suddenly being spawned in a place with no clues or context — you have no idea how you got there, but you don’t have the ability to question it either. Another thing about regular dreams is that it’s annoyingly difficult to recollect, and if I try to explain it, it’s going to sound weird. So, bear with me while I do. An apple dangled before me all of a sudden. It was not a golden apple. Or maybe it was. But I remember the color red, so I’ll go with the bright red apple for the sake of this explanation. I poked it repeatedly for some reason, and it broke. And from it, a creature emerged. It was either a crow or a rat, let’s go with the crow. It immediately fled, and I ran after it. It led me to a more dark and bleak environment where I saw the first group of red mages I consciously murdered in the eastern forest. They had apple trees grown through their bodies and poking out of their faces, just like I remembered. I approached closer, and they silently crumbled down into fragments of charcoal. That’s the extent to which I remember that dream. The thing to note here is that this dream was completely natural, like any human beings would experience. Right after that dream ended, I remember blackness surrounding me. When I say ‘remember’, I don’t mean vaguely. I vividly remember myself standing in the middle of absolute blackness where I was the only visible entity. And then this information popped up in my head. > Level: INFINITE > Mana Capacity: INFINITE > Mana Control: POSITIVE > Skillset: … Seal (Complexity - S , ???) … > Character Trait: Logical, Malevolent, Opportunistic, Calculating > State of Mind: Lucid Dreaming Either I accidentally activated my analysis skill in my sleep, or as per my theory (2-C) the virus interfered to give me lucid control over the dream. If it was a case of the former, then that doesn’t explain my level, mana capacity and control. So yeah, this was the virus’ interference. With my consciousness restored, I decided to start testing out the limits of this lucid dream. I recollected the events of the battle with Heath. And sure enough, the blackness that surrounded me transformed into the wasteland under the night sky. The scene was exactly how I remembered it to be, to the point where the details were astonishing. “So, it was you,” I heard Heath speak the words I remembered. He was wearing his white and gold cloak that he introduced himself with. “You’re the one responsible for killing our people in the eastern forest. I’m glad you showed up as I hoped, it’s nice to meet you…” Meanwhile, the dream version of me stood behind a regular apple tree with overgrown branches, without responding. The scene was going exactly how it actually happened, and I was watching it all from a third person POV. That’s when I noticed something odd. I walked towards the scene, getting closer and closer to the characters. The sicko was standing on the sidelines, incapable of doing anything as the battle raged on between Edith and Heath. It was around the time when Edith shoved a punch to Heath’s face and broke his nose, the sicko just ran off. Away from the warehouse and away from the battle. Nobody noticed him fleeing, which is what I found odd. Back at the estate, when I tried to recollect whether the sicko had survived the battle or not, I couldn’t find him in my memory. But now I was seeing every step he took as he was fleeing. ‘Pause,’ I spoke through thought, and the scene froze with Edith’s fireball hanging midway between her and her target with the handlebar mustache. I immediately realized what was going on, but it was technically only a theory. So, I decided to test it and confirm. I walked all the way up to Heath and resumed the scene. Obviously, none of the characters could see or react to me; I was practically non-existent as far as the scene was concerned. Heath raised his hand to use his magic to counter Edith’s fireball. ‘Slow down,’ I demanded of the dream, and everything was now in slow motion. Following that, I commanded, ‘Make the mana visible to my eyes,’ and white glowing particles clouded several areas of the battlefield, especially exuding out of the Edith and Heath. I further observed to see the flow of mana as Heath performed his cause and effect skill, whose functionality I was yet to understand. Not only did I figure out how the skill worked, I also pretty much confirmed my theory — I wasn’t in control of this dream. I mean, I was able to control the dream, but not directly. My commands were being executed by the virus instead. That’s why I was able to see things like the sicko fleeing, which I never paid attention to during the battle. Moreover, the whole scene was extremely detailed like I mentioned earlier, which could be explained by the virus recreating this scene based on my command rather than my less detailed visualization. As for Heath’s skill, it turned out to be very close to what I assumed. He basically uses mana to scan and determine the cause and effect of any physical action, and replicate it on a target. Additionally he can control which of the causes and effects to replicate in what combination, and to what degree to amplify it based on mana input. For example, take the moment he threw an unexpected gust of wind at me and Edith. His mana determined the cause of my breathing, which is inflation and deflation of the lungs. He replicated that effect and targeted it at us after amplifying it like a million times by consuming a ton of his mana. I took my sweet time analyzing the flow of mana to figure this all out, which made me rather annoyed to find out there was an instant way to acquire details about a skill. I just had to ask the virus for the skill’s pseudocode. Well, there’s no use pondering over it now. So, I shrugged it off and carried on dreaming. You see, I wanted to first know the extent to which I could make use of this virus-assisted lucid dreaming. That way, I can plan for ways to farm benefits off of it, perhaps even learn to control my strength. And that’s how I quickly realized the sheer extraordinariness of this dream. The so-called extent of this lucid dreaming was non-existent — there was simply no limit to the things I could do in there. And how did I realize this? It started with me walking away from the battlefield where Heath and the dream version of me were fighting in slow motion. I walked further into Kullu district and soon found a neighborhood. Out of curiosity, I entered and checked the houses. Sure enough, there were people inside. Some were asleep, some were reading, and some were having sex. Don’t label me as a creep just yet, I was checking the people out to see if I would recognize someone. And I did. I recognized 3 of the people I found in this neighborhood from an hour ago when I was watching people evacuate with the assistance of the city guards. In other words, the people I was seeing in this lucid dream actually exist in the real world despite the fact that I haven’t seen most of them. Furthermore, what I saw them doing is also accurate to what they were actually doing at that time. And yes, that means a couple was really having sex while I was battling Heath less than 2 kilometers away. Are you seeing what’s extraordinary about this lucid dream yet? If not, let me tell you one more thing I did in that neighborhood. I roamed around and found the bell that was for alerting its residents of an immediate crisis. I physically rang it, and the people within their homes came pouring out, confused by what was happening. Their expression of confusion and the panicked chattering all stopped when the thunder and lightning came. They saw the glowing tree with their jaws dropped as it grew and grew to the size I was familiar with. This lucid dream wasn’t merely a recreation of my past experience. Rather, it was the entire universe reconstructed at this specific point in time. So, I could go to the Andromeda galaxy and see whatever happened there during the time I was fighting Heath. If that wasn’t incredible enough, I was also able to interfere with the simulation, triggering the butterfly effect. All of this was being done by the virus. Naturally, I wasted no time to make use of this situation the best I could. And there were quite a few things I managed to pull off. If I were to start explaining each and every one of them, this chapter could go on for a while. So, I’ll just give you a brief rundown. 1) I observed Edith and learned how to fight. Although, it wasn’t simply observation that allowed me to master 27 styles of martial arts; that would have taken way too long. I actually made use of the virus, and commanded it to embed Edith's martial arts knowledge into me. It sounds like bullshit, but it worked. The instincts, muscle memory, techniques, and all else were cleanly transferred over to me. However, it wasn’t without problems. You see, all the muscle memory and instincts made me hypersensitive to potential threats. And you know what happens when I subconsciously react to threats. So, I reversed some of the effects, I gave up the instincts, muscle memory, and other aspects that made me touchy. 2) I tracked down the 3 remaining Immortals, and studied their skills. ‘Locate humans with S level complexity skill: Immortality. Search radius: the entire planet,’ was the command I thought of, and it revealed me the coordinates of all 6 of them. Ignoring Edith, Devon, and Heath, I teleported to the other 3. Two females and one male. Unlike the dynamic between Edith and Devon where Edith is the strongest one, it was different among the castaways. Heath and the other male immortal were significantly stronger than the females, which further strengthened my suspicion that perhaps the Omnipotent faced an issue with coding the male robot as the fighter and the female as the supporter. 3) In addition to locating the other 3 immortals, I used them to sharpen my battle skills. I simply made myself visible to them, and repeatedly provoked fights. I won’t lie, I was having a lot of fun kicking their asses while getting super creative with my seed modification skill. Especially with my new athletic capabilities that came along with the martial arts techniques, I fought those 3 with style. You may be concerned about my dream battle affecting the real world. But rest assured, there is no real danger as long as I’m lucid dreaming with the assistance of the virus. You see, the virus was occupied with listening to my commands and controlling this dream, which confirms that the virus is aware of my lucid dreaming state. So, there’s no reason for it to react to my dream activities in the real world. However, if I’m physically threatened by something in the real world, that’s a different story. Anyway, that’s about all the things I managed to do during this dream session. Sure, there were plenty of other things I hadn’t tried out. But for one, they weren’t too important or I failed to realize it, two, I didn’t want to spend too much time in the dream, and three, I can lucid dream any time I want so it’s all good anyway. By the way, if you’re wondering why I didn’t just use this opportunity to look into the future and solve all of my problems immediately, the reason is I couldn’t. I mean technically, I could but it’s not as convenient as you think. You see, the future is solely based on the present point in time. And the number of futures that can be derived from the present are infinitely many, all of which are equally probable. In other words, there’s no way to look into a specific future out of the infinitely many and make my life easier. Furthermore, looking into the future itself will create a recurring loop since there will now be more futures that are derived from the present where I’ll be aware of a particular future. It’s best not to think too much about this stuff. The concept of time travel is riddled with paradoxes, because it’s simply not possible to achieve in a practical way. ‘End simulation,’ I commanded as I was finally ready to wake up. My surroundings returned back to absolute blackness, and I concentrated to allow my consciousness to leave the state of lucid dreaming. I slowly opened my eyelids, and the blackness was replaced with branches and leaves, and the rope that was tied to my hammock. I remained laying down for a few seconds to allow my brain to get booted up. There was still no sound I could hear other than my own breath, meaning the enchantments were still in effect. I pulled my body and got down from the hammock, on to the giant branch below. “Hm, that’s weird,” I mumbled, seeing the sun setting before me. With the sun’s orange hue reflecting off my face and irises, I thought to myself, ‘Looks like only a few hours had passed while I was asleep.’ I was so sure that I was asleep for at least 12 hours though. But if only a few hours had passed while I was lucid dreaming… I brought up my palms to my face and triggered the analysis skill. > Level: 387 > Mana Capacity: 54000 > Mana Control: A+ > Skillset: … Seal (Complexity - S , Activated) … > Character Trait: Logical, Malevolent, Opportunistic, Calculating > State of Mind: Thrilled Is this the best day of my life? With just a few hours I managed to raise my mana control from F to A+? Based on this, I would say the peaceful life I’m aiming for is just around the corner. Wouldn’t you? I stopped my involuntary release of mana, wearing off the enchantment, and the sounds of thunder returned. After packing up everything I had brought along, I was all set to fly back down and back home. This called for a huge celebration. Moreover, I didn’t have to use the same 3D space navigation skill to get down. With my current mana control, I could develop a proper flight skill. And that’s what I did. > Skillset: … Flight (Complexity - B+) … This skill was also quite simple. Just imagine Ironman with a see-through suit. Admittedly, it still burns half the mana required by the 3D space navigation skill, which is a lot. But the important thing is that this skill is more comfortable to use and easy to maneuver. Still feeling immense amounts of joy, I descended the tree, passing the thunderclouds. And then I saw something that made my smile disappear — a huge wall surrounding the area of the tree that didn’t exist when I went to sleep. There was another thicker wall surrounding the trunk of the tree, which was connected to the outer wall through a roofed pathway. Surely, this couldn't have been built in a few hours. Maybe, Just maybe… I’ve been asleep for a little longer than that. Chapter notes:Zenith's interference in the lucid dream does not affect the real world. The lucid dream is simply a simulation.
352 Guide From An Elite 1 Player | REMASTERED For Fifa 21
Summary
Last year, I wrote a guide for the 352 tactics I use to earn Elite finishes in the weekend league. I was surprised by how much all of you liked it and I've been receiving some requests for a FIFA 21 reprisal.
Three weekends into Fifa 21, I have achieved three straight Elite finishes (two Elite 2s and one Elite 2 that should have been an Elite 1 if not for a thunderstorm, a tree, and a powerline deciding to do the horizontal mambo) and I am rather confident in putting out this Fifa 21 Remastered 352 Guide. I have made some big changes and I will be sure to cover all of them below. I am going to use a format similar to the one I used previously. First and foremost, No, this is not a Drop Back meta-slave setup and once again, this is a VERY lengthy guide in which I will cover player types to use, instructions, tactics, and more. I spent a good amount of time working on this, so if there is anything I did not cover and you have questions please feel free to ask me! Cheers!
Miscellaneous things to know before you start and FAQs.
Why I like the 352 over the 4231 and 442.
Custom tactics and why you need at least 3 different setups.
Instructions for each position.
Player Archetypes for each position in my 352.
Chemistry Styles
Substitution Philosophy.
My play style.
Tips for making the change to the 352.
The teams I have used thus far and my pre-toty target.
Closing Remarks
1. Miscellaneous things to know before you start and FAQs.
This guide is best viewed in a web browser due to the use of bulleted lists and indentations.
Changing to the 352 will not automatically make you go from Gold 3 to Gold 1, Gold 1 to Elite 3, etc. Like anything in this life, it takes practice.
I am not a pro, streamer, nor youtuber. I am a regular dude who happens to like playing Fifa, a lot. I don't have any gameplay videos saved.
You will lose games against opponents using the 4231 and 442. The 352 is not a miracle cure.
Contrary to popular belief, defending with attackers has been severely nerfed this year.
Do not try to use Adama as a wide mid thinking that his pace and strength will make up for his lack of defending. You will get exploited.
A 4 star weak foot is not all that weak.
AI defending did not get a buff and AI blocks aren't as difficult to contend with as you may think (although, they are frustrating as hell when they happen)
Beating team press is very easy and it's honestly just fun to exploit. I will explain why and how in this guide.
With the addition of the Creative Runs, EA has severely nerfed the natural off-the-ball runs your own AI perform. For this reason, I highly recommend that you never use Balanced as your offensive mentality for any squad you are running, be it 352 or other.
My camera angle is the Co-op angle.
Interestingly, EA has added a new hidden change with respect to positional instructions that makes the 352 even more deadly. In the past, if two players swapped naturally during the run of play due to some circumstance (ie, your CDMs flip, your CAM and RCAM flip, etc), they kept the instructions of their original spot. Not this year. If your LCDM and RCDM flip spots naturally during the course of play, they will also flip their instructions. This is important for a scenario where you place complimentary instructions on your CDMs. That is, if you have your LCDM on stay back and your RCDM on get forward and you somehow dragged your LCDM forward, your RCDM will stay back rather than still getting forward like his instruction tells him to do. This is new and a very welcome change.
Big thanks to u/El-Buncho and his idea for some of the graphics I used in this guide
2. Why I Like the 352 Over the 4231 and 442.
Let's take a look at how the 352 matches up against the two meta formations. On defense, the 352 has 3 CBs, 2 wingbacks, and 2 CDMs for a total of 7 eligible defenders to contend with your opponent's attack. Stop thinking of your eligible defenders as separate positions. On Defense, you have 7 Defenders and their sole job is to win the ball back. Don't be afraid to pull players out of position. Don't overdo it, though.
4231 - This formation has 4 attackers, 2 CDMs, and 4 defenders.
When you are defending against the 4231, it is very likely that your opponent has gone full meta and is using stay back on their CDMs and fullbacks. This means they have 4 attackers and 2 holding midfielders. The holding midfielders aren't a threat to do much so you don't really need to worry about them all that much. You have 7 defenders to contend with 4 attackers, 6 attackers if they use their CDMs more aggressively. Your wide midfielders can man mark the LCAM and RCAM. Your two CDMs focus on their CAM and Striker. And your 3 CBs are gravy here. Literally cleaning up anything that gets through. (but u/wahoos22, what if they're just passing around with their CDMs and CBs? You can harass the opponent CDMs with your CAM and CBs with your strikers, if needed).
442 - This formation has 2 attackers, 2 wingers, and 2 CMs.
When you are defending against the 442, it is very likely that your opponent has gone full meta and is using stay back on their fullbacks and at least 1 of their CMs. This means that they have 5 attackers, 6 if they let both of their CMs get forward. In the 442, the CMs are much more of a threat than in the 4231. Your wide midfielders can mark the opponent LM and RM. Your two CDMs mark against their two CMs, and your 3 CBs take care of the 2 strikers. The more meta your opponent is, the less players going forward you will have to contend with and the easier it is to defend against.
Going on the attack, the 352 is overwhelming without leaving you caught out. This will be covered more in the My Play Style section.
3. Custom Tactics and Why You Need at Least 3 Different Setups
This play style requires 3 (sometimes 4) different setups. A standard play setup, a come from behind setup, a hold on for the win setup, and a my-352-isn't-working-this-game setup (yes it will happen. sometimes you just need some variety to break down a very strong defensive opponent). Below is a text version of the tactics with some explanations on why I choose what I choose. If you would like a visual version, please refer to these links:
Standard Play: Use this when the game is tied, or you are up/down by only 1 or 2 goals. Basically, use this when it's a close match.
Defensive Style -- Balanced
Width -- 4 out of 10
Depth -- 4 out of 10
Offensive Style -- Long Ball (Last year, I used both Long Ball and Fast Build Up. This year, EA has changed the way your team comes back on defense when using Fast Build Up. Specifically, your players will be out of position more often, which is in line with the Fast Build Up description. For this reason, I no longer recommend it as an option.)
Width -- 8/9 out of 10
Players In Box -- 5/6/7 out of 10 (This will vary based on the natural off the ball movement of your players. Test it out for yourself.)
Corners -- 1 out of 5
Free Kicks -- 1 out of 5
Come From Behind: Use this when you are down late and need a quick comeback. Be careful when using this setup as you are throwing the kitchen sink at your opponent and are very susceptible to counters.
Defensive Style -- Balanced (Last year, I recommended Constant Pressure here. With the addition of Team Press, Constant Pressure is no longer worth it and actually only serves to drag your team out of position. For this reason, I no longer recommend it as an option.)
Width -- 5 out of 10
Depth -- 9 out of 10 (10 out of 10 just feels glitched for some reason, again)
Offensive Style -- Long Ball (Last year, I used both Long Ball and Fast Build Up. This year, EA has changed the way your team comes back on defense when using Fast Build Up. Specifically, your players will be out of position more often, which is in line with the Fast Build Up description. For this reason, I no longer recommend it as an option.)
Width -- 10 out of 10
Players In Box -- 10 out of 10
Corners -- 5 out of 5
Free Kicks -- 5 out of 5
Hold The Lead: Use this when you are up late and need to hold on. Don't abuse it or use it for extended periods of play as DDA will kick in and you will concede.
Defensive Style -- Drop Back (But u/wahoos22, you said it wasn't gonna be a drop back meta??? It's not. This is a legitimate strategy that should be employed toward the end of a match you are winning, especially against an opponent who is clearly better than you.)
Width -- 3 out of 10
Depth -- 3 out of 10
Offensive Style -- Possession (Your goal here is to hold on, not to score. Last year, I recommended both Possession and Balanced. EA changed the way your team's natural off-the-ball runs happen. Balanced is extremely static this year. For this reason, I no longer recommend Balanced.)
Width -- 4 out of 10
Players In Box -- 1 out of 10
Corners -- 1 out of 5
Free Kicks -- 1 out of 5
My 352 Isn't Working: Use this when you just can't seem to create any scoring opportunities. I switch to this for about 1 opponent every weekend only. 4222 with the same Tactics as Standard Play.
4. Instructions for Each Position
Some of the positions below will have more than one set of instructions. This makes more sense given the context of section 3, immediately preceding this section. Goalkeeper: With how powerful through balls have become this installment of Fifa, proper goalkeeper instructions are very important. Not to mention that crossing is back.
Saving on Crosses -- Comes for Crosses
Saving Outside Box -- Sweeper Keeper
Centerbacks: Don't touch anything.
Attacking Support -- Stay Back While Attacking
Interceptions -- Normal Interceptions (You can choose Aggressive Interceptions here, but be warned: your defenders will tire faster and will make some great interceptions but can get caught out of position more easily. I don't think its worth it. Do not use Conservative Interceptions or Neymar et.al. will have a laugh at you as they prance around your back line.)
Center Defensive Midfielders: Depending on your ability to defend well manually with your CBs, you can be more or less aggressive here. You will/may need 3 different sets of instructions here. If you are a weaker manual defender, you may want to use the Hold The Lead instructions in all setups for more security at the back. Be honest with yourself and your abilities.
Standard Play -- Keeping in line with the philosophy of Standard Play, your CDMs need to be jack of all trades. You'll want your balanced CDM to Cover Center so that he doesn't drift wide while tracking back. Your CDM that stays back will want to Cover Wing to backup your wide mids. If one is caught out, the CDM will drift wide to cover that spot and your CCB can step forward as your LCB and RCB pinch inward. Defensive Awareness stat is very important this year for this reason.
LCDM (or RCDM, just pick one)
Defensive Behavior -- Cut Passing Lanes
Attacking Support -- Balanced
Interceptions -- Normal Interceptions
Defensive Position -- Cover Center
RCDM (or whichever one you didn't do first)
Defensive Behavior -- Cut Passing Lanes
Attacking Support -- Stay Back While Attacking
Interceptions -- Normal Interceptions
Defensive Position -- Cover Wing
Come From Behind
Both CDMs
Defensive Behavior -- Cut Passing Lanes
Attacking Support -- Get Forward
Interceptions -- Aggressive Interceptions
Defensive Position -- Cover Center
Hold The Lead
Both CDMs
Defensive Behavior -- Cut Passing Lanes
Attacking Support -- Stay Back While Attacking
Interceptions -- Normal Interceptions
Defensive Position -- Cover Center
Wide Midfielders: These players are the workhorses of your squad. They won't score often and they won't register many assists, but if you skimp on these positions, you will get exploited. Your wide mids need to be able to defend. No, they don't need to body players like VVD, but they do need to do the job well. Outside of that, you can choose to go the pacey route or the technical route. At the early stage of the game, I recommend pacey as it is more forgiving, especially for those switching to the formation for the first time.
Standard Play
Defensive Support -- Come Back On Defense
Chance Creation -- Balanced Width (Last year, I also recommended Free Roam here. With the addition of Creative Runs and the nerf to AI runs, I no longer recommend this.)
Support Runs -- Balanced (Last year, I recommended Get In Behind here. I did this because we were also using Fast Build Up. With the nerf -- more of a correction than a nerf -- to Fast Build Up, we no longer need Get In Behind because of the Long Ball mentality.)
Support on Crosses -- Balanced (Last year I recommended Stay On Edge Of Box For Cross. I stated that the reason for this was "because the game is weird and the Stay on Edge instruction helps to stop your players from over-running passes." Given that EA has fixed that beyond stupid overrunning mechanic, this is no longer necessary and we can use the much more logical Balanced option.)
Interceptions -- Normal Interceptions
Come From Behind
Both LM and RM
Defensive Support -- Stay Forward
Chance Creation -- Stay Wide
Support Runs -- Get In Behind
Support on Crosses -- Get Into Box For Cross
Interceptions -- Normal Interceptions
Hold The Lead
Both LM and RM
Defensive Support -- Come Back on Defense
Chance Creation -- Balanced
Support Runs -- Come Short
Support on Crosses -- Stay On Edge of Box For Cross
Interceptions -- Normal Interceptions
Central Attacking Midfielder: Once again, your CAM is your most important player and will score the majority of your goals. His instructions are the same in all setups. It may sound strange, but this really is your best player. He will not only score the most goals, but will have the most assists. (But u/wahoos22, that doesn't make any sense! Your CAM should be the creator for the strikers!?!? Normally you'd be right. More on why in the My Play Style section).
Defensive Support -- Stay Forward
Support On Crosses -- Balanced (Last year, I recommended Stay On Edge Of Box For Cross. I stated that the reason for this was "because the game is weird and the Stay on Edge instruction helps to stop your players from over-running passes." Given that EA has fixed that beyond stupid overrunning mechanic, this is no longer necessary and we can use the much more logical Balanced option.)
Positioning Freedom -- Free Roam or Stick To Position (This depends on the natural off-the-ball movement of your CAM. Test it out for yourself. I tend to like Stick To Position better this year. Just don't use Drift Wide. It's trash for your CAM.)
Interceptions -- Conservative Interceptions (Lower stamina players will not tire as quickly with Conservative instructions. If stamina isn't an issue, you can use Normal).
Strikers: Again, it may sound strange, but these players are more creators than goal scorers (but having absolute rockets of shots here doesn't hurt!). This year, you need at least one striker that is good in the air. More on why in section 7.
Standard Play and Come From Behind
Left Striker -- A playmaker and space creator
Support Runs -- Drift Wide (Last year, I recommended Stay Central on the Left Striker. With the addition of Creative Runs and the nerf to AI runs, I have experimented and found that Drift Wide on both strikers results in a much more dynamic and mobile front line. I recommend either Balanced or Drift Wide, but never Stay Central unless you're using a player like Ibrahimovic or Giroud, who are just slower than drying paint.)
Attacking Runs -- Balanced (Last year, I had a firm recommendation for Balanced on the Left Striker. This year, I no longer have a hard recommendation. Similar to the CAM, this instruction will depend on the natural movement of your chosen player. Test it out for yourself.)
Interceptions -- Conservative Interceptions or Normal Interceptions
Defensive Support -- Stay Forward
Right Striker -- A playmaker and space creator
Support Runs -- Drift Wide
Attacking Runs -- Get In Behind
Interceptions -- Conservative Interceptions or Normal Interceptions
Defensive Support -- Stay Forward
Hold The Lead
Both Strikers
Support Runs -- Balanced
Attacking Runs -- False-9
Interceptions -- Conservative Interceptions or Normal Interceptions
Defensive Support -- Come Back On Defense
5. Player Archetypes for Each Position in My 352
A player archetype simply means the type of player I aim to use in each position. My top choice in each section will be bolded. Note that just because a player is my top choice doesn't mean I am currently using them. Also, note that I will not be bolding any icons here because that wouldn't be useful information. I will give cheap (under 100k), middle of the road (under 500k), and expensive (500k+) options for each position. Please keep in mind that these are examples of players you can use. Some are better value for coins in terms of what they provide to your team versus the costs to buy them. For instance, Cancelo is probably a better option over Walker for RM -- not only will Cancelo be better as a RM and is cheaper, but also NIF Walker is better suited for an outside CB role in the 352.
Goalkeepers
Literally whatever you want. Goalkeepers are a feel type of thing. I like Neuer
CBs - Try to get a Lefty at LCB (or at least 3 star weak foot Righty) and put the least agile CB you have at the CCB position
Klosterman, Laimer, Manolas, Alaba, Diego Carlos, Koulibaly, Llorente, Valverde, Zakaria, IF Delaney
VVD, Joe Gomez, Varane, NIF Walker, Mendy, Rule Breaker Laporte
IF Walker, 85 Ferdinand, 92 Maldini, 87 Carlos Alberto
CDMs
Alaba, Llorente, Valverde, Zakaria, Fred, Wijnaldum, IF Delaney
Kante, Pogba, Baby Lahm, KDB, IF Sanches
Gullit (mid or prime when it comes out), Zidane (mid or prime when it comes out)
LM/RMs
Davies, IF Florenzi, IF Corona, Jordi Alba, Atal, Cancelo, Cuadrado, Hakimi, Gosens
Mendy, Walker
Zambrotta, Roberto Carlos, Ashley Cole
CAM
Reus, Carrasco, Dembele, Ben Yedder (Eww), Dybala, IF Depay, Griezmann, Hazard, Mertens, League Objective Mollet, Bobby
I will outline the typical chemistry styles I use for each position. Just because I typically use a certain style, doesn't mean I always do so. There are exceptions to every rule.
Goalkeepers
Eh? Basic is fine. Glove too
CBs
Depending on the CB, you'll likely want shadow
At this stage, you can get away with Catalyst on some of the top tier defenders as they don't need the defending boost and the pace boost is the same (VVD for example)
If its a player like Walker, I'd use Anchor over Sentinel
I am a firm believer that Anchor is always better than Sentinel -- and it's not for the pace boost either. I like the defensive boosts of Anchor better than Sentinel
CDMs
Shadow, Catalyst, or Engine
Physicality is important in the midfield but Pace is more important to ensure they can track back quickly enough to be in position
Wide Mids
Hunter or Catalyst
I typically use Fullbacks as my Wide Mids and they typically have high enough defending that they don't need a boost. If your Wide Mid already has around 75 defending, don't worry about boosting their defending.
I am using Gladiator on Davies
CAM
This varies wildly.
Hunter on Neymar, Artist on CR7, Catalyst on Ben Yedder, Finisher on Depay, etc
plz don't run cr7 at CAM
Strikers
Hunter, Finisher, Engine
7. Substitution Philosophy
Your subs are different when running the 352. In order to dominate the entire match, you will want to bring on a new LM and RM at around the 60th to 65th minute (Workhorses remember?). That only leaves you with 1 more sub. This is where it's entirely up to you. I have 4 subs on my bench. 2 wide mids, one attacker, and one defender. If I have a rather large lead and feel I don't need to attack voraciously, I will sub off my more attacking CDM for my defensive CDM (if any of my CBs or CDMs has a yellow, I will sub them off instead for the added security of not getting a red card). If I am not all that confident in my ability to just hold the lead, I will sub off whichever attacker feels the most sluggish and in need of a breather. If you get to the point that your attackers are Neymar, Mbappe, and CR7, well congrats! Never sub them off lol
8. My play style
I will save you some time here. Not much has changed in the play style department. Feel free to re-read as a refresher. In this section, changes from last year have been bolded for easy reference. It's all about Triangles. You have them everywhere. You should aim not take more than 2 touches before passing it off. This obviously doesn't include when you've played the ball in behind to your wide mids. One touch passes between your LM-LCDM-LCB and its right side equivalent will draw out your opponent's forward RCAM allowing you to get in behind the RCAM and in front of the fullback. Now you can look to either the LM-CAM-LST or LM-LCDM-CAM triangles (or their right side equivalents) to do the same to beat the fullback and get in behind. If your opponent catches on to this and begins to overload that side or manually pull players out of position to defend it, you can start to do the one touch passes between the LM-LCDM-LCB but instead of playing it forward to the LM, you can switch the play to the RM who will be in behind the opposing fullback due to your opponent's defensive slide. You can also play the LCDM-RCDM-CCB and LCDM-RCDM-CAM triangles to do the same. The ideal situation here results in one of your CDMs making a forward run and receiving a pass. Then you play the ball off to one of your strikers. By now, your CAM has made an unmarked run from deep. You lay the ball off for an uncontested shot on goal. You can play the ball in behind to your Right Striker (if he's truly in on goal, take the shot). He will likely be slightly out wide to the right and have pulled the opponent's LCB out with him. Your Left Striker will move centrally to look for a pass pulling the opponent's RCB to the middle of the field. Now, you are looking for one of two scenarios. The opponent's right fullback will either move centrally to mark your CAM or he will stay wide to mark your LM. Either way, you've created an unmarked player you can pass the ball off to for either a shot or a ground cross. If you can't create any easy shots and your opponent is sitting on the top of their box blocking everything, that's why you have two well-rounded CDMs and why Creative Runs have been added. Practice making use of the Creative Run mechanic to 1) make a custom run to play a pass or 2) make a custom run to clear some space for you to dribble. Also, interplay between your CDMs, your CAM, and your Wide Mids will eventually draw your opponent out resulting in an opportunity to play into one of the strikers for a shot. Don't forget that crossing is back. Don't forget your standard interplay between your front trio. Give-and-go's are always great. With the addition of the Team Press mechanic, you need a consistent and safe way to beat that press. As you may have noticed, the Team Press mechanic is essentially a command to "go man mark tight like you're playing one-on-one basketball." It's extremely effective against an opponent that panics. If you have at least one striker who is good in the air (CR7, Haaland, Lewa, Lukaku, Giroud lol, Rashford with Marksman, etc) essentially you have a free attempt at goal waiting for you. As soon as you see the team press coming, immediately pass back all the way to your CBs or even keeper. You're trying to draw your opponent in to your half. Then, play a lobbed pass up to your striker, head it down to your CAM/other Striker and you've got an instant goal scoring opportunity. When you lose the ball, your CDMs and CBs will already be behind the ball. That's 5 defenders to your opponent's 4. Then, your LM and RM will immediately back track due to their Come Back on Defense Instructions. Now you have 7 behind the ball (but high up the pitch) compared to your opponents max of 6. The more you play with the formation, the more you will understand how to draw your opponents out rather than just playing in behind to ASM and Adama in the 4231 and hopping you get a shot off.
9. Tips for Making the Change to the 352
Wow, you've made it this far. Thank you for reading the Remastered version of my guide! Here is a short list of suggestions on how to make the change to the 352 from whatever formation you currently play.
Don't play any passes you aren't 100% sure will connect. You should aim for 90%+ pass accuracy each game. Looking at my losses in weekend league, they all have 1 thing in common: below 90% pass accuracy.
Get players with high dribbling stats until you learn the ins and outs. This will allow you to hold the ball if you can't find passes right away
Don't be afraid to just stand still with your CDM if your opponent is just sitting on their box. Eventually, they'll get frustrated, press you, and leave an open pass for you to make
Be patient. Don't sprint (sprint less)
Practice in Squad Battles on Ultimate. The AI cheats, especially with that B.S. competitive setting that was added this year. But if you can pass around the AI on Ultimate, you can pass against a real person who is actually capable of making mistakes.
Try to think outside the box on your passes. Play a lobbed pass (square on PS4, X on xbox) from your RCB to your LCDM, for instance
Don't be afraid to pass all the way back to your CBs and your keeper. Resetting is often helpful in luring out your opponent's defense.
10. The teams I have used thus far and my pre-TOTY target
Pre-TOTY Target Squad (the icons in this squad are just placeholders for icons earned from Icon Swaps, an obvious caveat here is that promo cards that have yet to be released may shift what my goal is)
Using the same players for when you need some variation to break down your opponent. Here you can see how I would line up without making subs.
If you can, you'd use your attacking substitute to fill out one of the wide CAMs
11. Closing Remarks
If you made it this far, thank you so much for reading. I am not a pro fifa player, I'm not a youtuber or twitch streamer. I just play fifa. I really hate that people feel pigeon-holed into using a meta formation. That is why I am continuing to share my 352 tactics with all of you. I will try to respond to as many comments as I can. Thanks again!
My Big Recommendations List for the Steam Winter Sale
This has been an absolutely miserable year but finally it’s coming to an end, and even looking up now that Facebook and Google are being sued by Federal and State governments. If you played Cyberpunk I’m sure you’ll also have your fingers crossed that both companies get the sledgehammer into little pieces, with Amazon and the App Store soon to follow. Next year is up in the air right now; it could be the year XR is completely strangled by those soulless corpo’s at Facebook, or it could be the year that OpenXR, anti trust action, and consumer apathy towards VR cut their legs out from under them. Things look completely up in the air at this point. So take the holidays and enjoy VR while you still can, next year we might just be playing Valve’s Citadel while the ship goes down. Well Steam’s Winter Sale is here and it’s a great time to pick up a lot of great games, hidden gems, and so on. This is my list of games to pick up. Some of them are the best prices these games have ever had. I categorized them by price tier, and I put a few standouts in bold either because they’re a great game or a great deal, or both. Merry Christmas [I also made a hardware guide for headsets and PC components, a guide to using steamVR, a guide about how to use the Index for AR, and a master acab list of great VR games, demos, and software] The Sale ends on January 5th at 10AM PT
PAYDAY 2 (-90%, $0.99) Has a full VR mode that makes the whole game VR and lets you play with flatscreen players. It’s a lot more impressive than you would expect, especially at this price (free with the base game). It has two handed guns, full access to all the content and crossplay with non VR players, a UI on your tablet watch, etc
Half-Life 2 (-80%, $1.99) You need to use Garry's Mod to run this in VR but the whole game works.
Naked Sun (-90%, $0.59) Two hand wave shooter style game where you’re being moved through a robot city and fighting ogg enemies with guns and a shield.
Scanner Sombre (-75%, $1.49) Spelunking through echolocation and a great art style. At this price and with this concept I’d say it’s definitely something to experience in VR.
Steady (-50%, $2.49) Like the lockpicking puzzle from Alyx or those boardwalk games were you move a ring over wire without touching them together. 50 levels.
fpsVR (-20%, $3.19) This is a must have utility for SteamVR. My guide to using SteamVR explains why and how to use it.
Windlands (-90%, $1.99) the first windlands game, it’s a grappling hook style adventure exploration game.
Evolution VR (-51%, $0.49) This is like that first phase of Spore, where you’re an amoeba eating larger ones and evolving with new limbs. I consider it a steal at this price, although it’s going to become free soon according to the devs.
PROZE: Enlightenment (-85%, $2.99) Puzzle adventure game set in the tundra
Evil Robot Traffic Jam HD (-80%, $0.99) Tower defense
Interkosmos (-33%, $3.34) A space survival game where you’re sitting in a tiny broken space capsule and have to make it back to earth.
Neonwall (-90%, $0.99) Guide a ball through neon obstacle puzzles
Spuds Unearthed (-75%, $2.99) RTS TD type thing. I found its balance super frustrating when I tried it but it has a lot of polish and this price is great.
Squishies (-75%, $2.49) Puzzle game with nice art that looks polished
Zooma VR (-66%, $2.03) Look at the steam page, it’s basically an adaptation of that arcade game where you shoot colored balls at other colored balls to match them up and pop them.
Obstruction : VR (-68%, $3.19)
Fingers: Mini Games (-35%, $1.94) Screw around with finger physics mini games with your index controllers.
Chroma Lab (-40%, $2.99) Particle simulator that’s kind of trippy
Drone Hero (-90%, $0.99) Drone obstacle course game
Defendion (-80%, $$2.19) Laned fantasy strategy game
Bonfire (-50% $2.49) A little story where you’re crash landed on an alien planet with Ali Wong and meet cartoon aliens
Cliffstone Manor (-75%, $1.99) Difficult escape room style game
Moonshot Galaxy (-65%, $1.74) space mini golf game
Protogon VR (-80% $1.99) Combination minigolf pinball game with neon crazy graphics
Power Tools VR (-50%, $0.99) Chip away at a stone block with power tools
Race The Sun (-80%, $1.99) Endless forward obstacle racer with options VR support
SpellPunk VR (-73%, $2.96) Competitive spell casting game
Strings (-90%, $0.99) It’s a smaller, more basic game, basically a shooter with different items you use to fight enemies as you teleport around stages.
SweeperVR (-50%, $1.99) Minesweeper in 3 Dimensions
PolyCube (-50%, $2.49) complex 3D tetris
UNTITLED (-50%, $2.49) 3D surreal puzzle game
Intruders: Hide and Seek (-90%, $1.99) Gamepad horror game
WRG games bundle (-96%, $0.65) Escape room and a non VR game
Apex Construct (-75%, $4.99) This is where the energy battery puzzles come from. It's early VR but really strong on story, progression, and interactions, the combat is mostly archery
FORM (-70%, $4.44) “A surreal adventure where puzzles are built from dreams and memories”
NIGHTSTAR: Alliance (-60%, $3.99) Bullet Hell in space, but with a story and customization
Blasters of the Universe (-75%, $3.74) Bullet Hell with a lot of polish and progression and you unlike new weapon parts
FREEDIVER: Triton Down (-50%, $4.49) Drowning simulator, shorter but high quality
Keep Talking and Nobody Explodes (-70%, $4.49) This is one of the best VR party games, easy to play remotely or in the same room with other plays holding a printed out or mobile browser manual helping the VR player disarm a bomb.
Out of Ammo Fun Bundle (-78%, $4.48) A bit rough but still getting updates and still low poly fun. First one has multiplayer. They’re both FPS/RTS but the first one is war themed, while the second one is a zombie game.
Orb Labs (-50% $4.49) A stealth puzzle game where you use different orbs to complete puzzles around lasers, turrets, and other hazards.
Thumper (-80%, $3.99) Best selling surreal rhythm game, best with a gamepad. I definitely recommend it if you are fine with the gamepad controls.
Vetrix (-20% $4.79) Tetris inspired. It has a two layer deep grid allowing for lots of 3D shapes that you can stick into place by hand in a twist on the usual formula. It has its own 8bit tunes, special blocks, multiple modes, and a bunch of color profiles based on the gameboy’s aesthetic.
Transpose (-75%, $4.99) A game where you solve puzzles with a recording of yourself. It’s one of the best and more creative puzzle games in VR.
Operation Warcade VR (-75%, $4.99) Old but the concepts work really well. It’s like a 3D light gun game that pulls you in for some moments
Echo Grotto (-50%, $3.99) Echo Grotto is a spelunking game with stylized graphics. You pick your gear and then use a throwing based teleportation system that leaves a trail behind you.
HATCHICK (-75%, $3.74) Like Xortex from the lab, a bullet hell inside a dome
Journey For Elysium (-50%, $4.99) Greek mythology adventure game, a black and white art style
Just In Time Incorporated (-75% $3.74) You appear in slow motion to save people who have Just In Time Insurance. Super basic graphics but the gameplay is fun and for this price it’s a good buy.
Psychonauts in the Rhombus of Ruin (-75%, $4.99)
Shooty Skies Overdrive (-50%, $4.99) It’s a bullet Hell with polish and a voxel style.
Portable Farm (-20%, $3.99) It’s a light farming game, but the hook is that this runs on top of other games like an overlay.
Balloonatics (-65%, $3.49) Single and multiplayer hot air balloon combat. A big update is coming.
Axegend VR (-50%, $4.99) Tower Defense mixed with some fantasy combat
Buzludzha VR (-60%, $4.79) If you like VR tourism then this is pretty good.
Carnival Games VR (-75%, $4.99) Party game style game. It crashes unless you turn off the game’s haptics in input bindings
Bandit Point (-50%, $4.99) Renaissance robot shooter where you possess different robots in combat
Downward Spiral: Horus Station (-70%, $5.99) Zero G space thriller
Flotilla 2 (-50%, $4.99) Turn based RTS in 3D between space battleships
VR Furballs - Demolition (-60%, $4.79) Angry birds style game
Townsmen VR (-50%, $4.99) This was barebone and felt like a demo, but it’s going to get a big update that scales it up into a game and should be free for anyone who owns this version.
Starblazer (-75%, $4.99) A 3D space RTS with multiplayer
Skyworld: Kingdom Brawl (-50%, $4.99) This is a classic VR RTS scaled down to a quick 1v1 RTS battle.
RuneSage (-60%, $3.99) Open world puzzle fantasy game
2945VR (-45%, $3.29) Space shoot em up
Groundhog Day: Like Father Like Son (-33%, $10.04) Sequel to the movie with a similar idea where you relive the same day over and over and progress
HORIZON VANGUARD (-33%, $10.04) Sega Saturn Style arcade shooter on a hoverbike. Don’t let the graphics fool you, this is a really well made puzzle game in a Sega Saturn style
Fujii (-35%, $9.74) Gardening with a weird forest spirit
Garden of the Sea (-50%, $5.99) Animal Crossing looking zen farming game by the devs behind Budget Cuts 2, early access but steady updates are coming adding features and more mechanics..
GORN (-50%, $9.99) Cartoon melee colosseum game, VR classic that has killed a thousand controllers
Contractors (-50% $9.99) smallest player base of the big shooters but full of good ideas and strong gunplay. Now has mod support, including custom maps, weapons, and modes like world war II, ninja warrior, Halo, etc
1976 - Back to midway (-50%, $7.49) Just came out, it’s a good game, already on sale. This is a good deal. This is a 2.5D shoot em up that has “immersion zones” where you take direct control in first person. It really captures the idea of stepping inside an old arcade machine really well.
Creed (-75%, $7.49) This is a pretty good multiplayer boxing game that goes for a more arcade style, Graphics are good, it’s polished, and obviously it’s licensed from the movie
Bizarre Barber (-50%, $5.99) Arcade game about cutting aliens’ hair as they come by in passing subway cars. It goes for a more surrealist vibe.
Garry's Mod (-33%, $6.69) This needs a community hack to be VR, but it works and even lets you play HL2 in VR
Cubism (-20%, $7.99) A tetronomo style puzzle where you need to figure out how to make the finished shape out of the pieces you’re given, in 3D. Feels like it’s made by Apple.
Gravity Lab (-40%, $8.99) Rube goldberg puzzler where you build machines to get the ball from the start to the finish, sci fi settings.
Pierhead Arcade Bundle (-63%, $7.48) The first one is stronger and a great little VR boardwalk with multiplayer to show off to people with high quality minigames,and with an update this week they made it so if you own both, then the games carry over into 2, which has index support and a ton of its own games too.
Prison Boss (-60%, $7.99) The best crafting game in VR, you play a prisoner who makes and sells contraband, so it’s business sim as well since you buy equipment and supplies to make various products.
Tabletop Simulator (-50%, $9.99) (4-Pack for $29.99) (Most DLC -50%,) Look, the VR support here has issues but since it’s a board game simulation all you need to do is make sure you can sit down, move around, and grab things (just make your own bindings from the desktop SteamVR settings). Since it uses the Steam workshop it’s an insane value with endless excellent quality content. The matchmaking system means you can play all kinds of games at all hours with thousands of people.
Westworld Awakening (-80%, $5.99) If you love the show this is a must have, pretty well received as just a good game overall.
Superfly (-34%, $9.89) This is a super hero sim game in VR. You can have six different types of powers with their own movement and combat mechanics around a cartoon city
Ultrawings (-50%, $7.49) Super user friendly flight sim with VR controls. I definitely recommend it. You complete missions to get money to spend on new planes across several cartoonish islands that you fly between.
Shooty Fruity (-55%, $8.99) One of the best wave shooters in my opinion, but the controls are a little broken for the Index since it doesn’t use SteamVR input.
RUSH (-60%, $7.99) Wing suit skydiving game
Climbey (-31% $6.89) A classic VR climbing game with multiplayer and steam workshop support for courses
Space Pirate Trainer (-40%, $8.99) Everyone’s favorite wave shooter, one of the first wave of room scale VR games that came out with the Vive. There’s no progression but it handles the mechanics of dodging bullets and dealing with growing waves of enemies really well with a lot of modes for your weapons.
Spectro (-50%, $7.49) Ghost hunting game that feels a bit like it’s made for kids but it’s still a good roguelike.
The Curious Tale of the Stolen Pets (-50% $7.49) Cutesy puzzler abou finding a bunch of stolen pets on little floating islands you interact with.
ViSP - Virtual Space Port (-50%, $7.49) You build these blocky space stations in third person trying to hold off attacks by aliens.
A Fishermans Tale (-35%, $9.74) A recursive puzzle game where you’re a fisherman in a box messing with a fisherman in a box who has a fisherman in a box…
I Expect You To Die (-60% $9.99) A james bond style escape room game with a ton of polish and a lot of content, one of the best of the genre.
The Forest (-50%, $9.99) Port, has good co op, suniverseurvival with crafting and base building in a forest full of mutants.
The Mage's Tale (-70%, $8.99) I haven’t been able to try this one, but it’s well reviewed and has a nice art style.
2MD: VR Football (-30% $9.09) This is basically quarterbacking in VR. You throw the ball but you don’t run around with it. Also you throw with the trigger by default, for safety reasons. It’s still fun, but it’s definitely not a full football experience.
Deism (-30%, $5.59) This a god game with a low poly art style, it’s in early access with a lot of updates.
Cave Digger (-50%, $9.99) Steampunk mining game with multiple endings
The Thrill of the Fight (-20% $7.99) This is the more realistic boxing game more like a simulation, and it's good as a workout.
Carly and the Reaperman (-50%, $9.99) Escape from the Underworld (-50%, $9.99) One of the best asymmetric games, this is a co op platformer adventure where the VR player helps the gamepad player. Works with Parsec/Remote Play Together
Gun Club VR (-60% $7.99) For a gun sim, get H3. The value in this game are the missions where you have to hit cardboard targets across different themes and weapon types like WWII, modern day, zombies, or carnival style targets.
Swords of Gurrah (-30%, $6.99) Multiplayer sword fighting with a little community.
Hellblade: Senua's Sacrifice (-75%, $7.49) Port of third person game, really high quality but gamepad controls.
IL-2 Sturmovik: Battle of Stalingrad (-85%, $7.49) A HOTAS based WWII combat flight sim
Marble Land (-60%, $5.99) A physics base puzzle game about getting the marble to the goal
Combat Tested (-69%, $6.19) This is a mixed game, but it’s really creative with the gritty super powers you have while you try to escape from a lab full of people trying to stop you.
Blind (-75%, $6.24) You can only see by making noise (canes, throwing things, etc)
Adapt or Perish (-40%, $5.99) Evolutionary strategy game with a VR mode
Pinball FX2 VR (-60%, $5.99) Made for VR realistic pinball
Assetto Corsa (-90%, $7.93) Racing sim with optional VR
Seeking Dawn (-80%, $5.99) Not great, but super ambitious with story and alien enemies and crafting and base building and just generally more than I expected, and it actually kind of works.
Pavlov VR (-40%, $14.99) Pavlov is basically a game that set out to be Counter Strike VR and became the Garry's Mod of VR and the most creative community outside VRChat. I’ve seen and played everything from roller skate racing, a remake of the entirety of Super Mario 64, TF2 Payload, over a hundred TTT maps, some of the best Battle Royale I’ve seen in VR, Slow-mo zero G modes, SCP, LifeMod and DarkRP, five completely different kinds of zombie modes, and a lot more. It’s been a fixture of SteamVR and pretty soon they’re releasing a World War II update with character models and new guns for the USSR, USA, Germany, and UK, new maps, and multi user tanks that you use in first person. It’s as much a must have as there can be, as long as you like multiplayer shooters.
Vertigo Remastered (-40%, $14.99) A 19 year old genius kid who worked at Valve and Cloudhead games made this on his own. It feels like a scaled down Alyx with nice physics, creative weapons and tools, and great personality across a campaign.
Paper Beast (-30%, $13.99) One of the standout PSVR games. You’re in a surreal papercraft desert with dynamic and lifelike paper animals. It has a story and then a smaller sandbox mode. It’s a surreal style experience that works well in VR.
Jet Island (-35%, $12.99) take on a huge open world with an island of enemies on your hoverboard
Falcon Age (-35%, $12.99) You play a young falconer who uses her whip and bird to fight off colonizing robots that are strip mining her planet. It’s a pretty high quality game and semi open world.
Budget Cuts 2: Mission Insolvency (-50%, $14.99) VR stealth with a portal style teleport gun and a bow. It’s well written and has a lot of polish. Sequel to one of the standout classics of early VR.
Superhot VR (-40% $14.99) This is the game that sold me on VR. It’s basically the Matrix, where time moves when you move. It’s actually not a port of the original superhot, which is why the sequel isn’t coming to VR. I think it’s slightly overrated, there isn’t a ton of content, it just seems more concise than the marketing conveys
Gadgeteer (-20% $11.99) Even more rube goldberg puzzler, but more of a dominos style of gameplay.
Ironwolf VR (-30%, $13.99) Submarine simulator, has destroyer mode now too with coop and some competitive multiplayer. I definitely recommend this as a co op experience.
Hotel RnR (-40% $11.99) You’re a dead rocker who makes a deal with the devil to destroy hotel rooms
Duck Season (-35%, $12.99) Make someone else play this without explaining it to them. Tell them it’s just Duck Hunt.
Down the Rabbit Hole (-40%, $11.99) Third person Alyx in Wonderland game with player choice
3dSen VR (-40%, $11.99) 3D NES emulator that makes them feel like a totally new experience.
The Wizards Bundle (-68%, $15.92) The first one is an okay wave shooter, the second is more of an adventure game with great graphics and more variety.
Thief Simulator VR (-27%, $14.59) A semi open world game where you go around stealing people’s phones, jewelry, and cars.
Vox Machinae (-45%, $13.74) If you like Mech games this is basically a must buy, you control it by hand with all the bits and bobs of the cockpit and the graphics look really good. VR and flatscreen with crossplay multiplayer.
Yupitergrad (-15% $12.74) A grappling hook adventure game set aboard a collapsing soviet space station
Windlands 2 (-60%, $11.99) This is a grappling hook style game with somewhat basic graphics but large worlds and big enemies. Some people have called it the best spiderman game in VR.
Hello Puppets (-30%, $13.99) Cartoon horror with weird humor, your hand is an evil puppet
Moss (-50% $14.99) A third person platformer adventure game about a little mouse
Skytropolis (-55%, $11.24) A vertical citybuilder, which is a rare genre in VR. It’s from 2017 and doesn’t get updates any more but it does work and it’s not a bad game in the genre.
Pixel Ripped 1995 (-30%, $13.99) A love letter to 16 bit gaming. You play video games inside the game and have to avoid getting caught playing in the middle of the night, etc.
ModBox (-25% $11.24) This is a sandbox game creator with steam workshop support. IT has a lot of potential and supports asymmetric play, VR multiplayer, and creation inside and outside of VR.
New Retro Arcade: Neon (-35%, $12.99) This is kind of buggy, and you need to use the unofficial arcade builder, but as a social VR experience for friends it can be pretty cool. Roms aren’t shared online unless the other people are on parsec or something, but a few activities like movies, the built in games, and bowling are actually multiplayer. The arcade is persistent for you and your friends even if you’re doing different things in different rooms.
Phasmophobia (-10%, $12.59) The big new co op horror multiplayer game, but this one also supports VR
Synth Rider (-40% $14.99) This is the closest Beat Saber style game to the original, with a smoother style of gameplay. But the maps feel unbalanced, like every difficulty or gameplay setting is the exact same map just being automatically tweaked. This can make it feel unfair or constricting.
Into the Radius (-30%, $20.99) Basically Stalker VR, kill enemies and complete missions for cash as you progress
Mini Motor Racing X (-50%, $19.99) Racing game that you control with your actual hands which is great but the tracks can be pretty small and with lots of tight turns since it’s a micro car game. Also has a rocket league mode which is fun.
Stride (-25%, $14.99) Basically mirror’s edge in VR. You run and jump and wall run across different environments, with some combat and stealth too. There are two modes out now and another one coming soon with a story.
BattleGroupVR (-30% $17.49) This is probably the most polished RTS in VR, made by one dev but it’s right up there with final assault and works better in singleplayer. Multiplayer is being tested right now. It’s a space real time RTS where you’re on the bridge of one of your ships and you can command the others in holograms, see the battle in third person, and the graphics are great. There’s a story and campaign too
Until You Fall (-20%, $19.99) This is basically Infinity Blade in VR. It does melee by having lines appear in the air and you need to line up your sword with them to block enemy attacks, with some later enemies requiring you to duck off to the side to dodge attacks. It’s a roguelike so you fight through as many enemies you can, small stage by stage, until you die and spend the money you earned on new weapons and abilities.
STAR WARS™: Squadrons (-40%, $23.99) As an experience, Squadrons is exactly what you expect. It’s really immersive and really feels like being in a star wars dogfight
The Talos Principle VR (-60%, $15.99) Croteam are the devs of the classic Serious Sam series, and when the Vive came out they went all in and converted all their games over to VR, including their puzzle game Talos Principle. It was one of the higher quality experiences back then and it still holds up.
Tales Of Glory (-40%, $17.99) First person medieval war RTS. It’s been in early access for a long time but the dev has put in a ton of work and made it a pretty unique experience with some of the best medieval combat outside Blade and Sorcery combined with strategy and base capture.
Universe Sandbox (-33%, $19.99) Just got an update redoing the entire VR UI side of the game.
Automata Break (-15%, $16.99) An asymmetric tower defense game you can play with a friend or alone.
Skyrim VR (-67%, $19.79) Good port, works better than Fallout4VR with a big modding scene. This price is a bit higher than it has been in the past.
Ragnarock (-15%, $16.99) Rhythm game where you beat the drums on a viking ship to metal and celtic rock. This seems like the best beat saber style game I’ve seen alongside Synth Riders, and the music is distinct.
Industrial Petting (-15% $16.99) You farm alien pets to sell them back on earth. It’s an industrial production kind of game, with multiplayer support and VFlatscreen modes
In Death (-50%, $14.99) Roguelike archery game set in Purgatory. Price feels a little steep when it stopped getting updates on PC in early 2019.
Angry Birds VR: Isle of Pigs (-30%, $10.49) Basically Angry Birds in 3D. You can shoot in room scale and teleport to different spots to get a better angle. There's a fair amount of content too.
Arizona Sunshine (-63%, $14.79) The first big co op zombie game. It shows it's age but it's still popular and has some DLC. I would recommend this one only on sale and mostly if you're planning on playing co op.
L.A. Noire: The VR Case Files (-50%, $14.99) I think the cases are taken from the original game, but it's LA Noire in VR. There's driving, shooting, interrogations, looking for clues, everything from the original game. Seven cases.
Half-Life: Alyx (-25%, $44.99) The best looking VR game and one of the best games of this generation.
Boneworks (20%, $23.99) This game is a must buy, but do not get it if you’re new. This is a game where pushing on a wall with your hand pushes the camera back. It will make you sick if you don’t have VR legs. The combat, melee, physics puzzles, are all extremely strong and it has an 11 hour campaign, along with arena, zombies, and sandbox modes. Another content update is also coming soon.
The Walking Dead: Saints & Sinners (-20%, $31.99) This is a great game. It’s less Left for Dead and more realistic in the sense that tension is very high and both humans and zombies are threats. There’s light crafting, upgrades, and collecting supplies, complete with physics and a faction systems and multiple paths to go down.
Vacation Simulator (-20% $23.99) The best minigame collection game with the games integrated into three worlds with a lot to do, across multiple settings with progression and a basic story. Super immersive.
No Man's Sky (-50%, $29.99) All new updates apply to VR too. Performance is spotty but the entire massive experience is carried over into VR, and there’s multiplayer too.
Hot Dogs, Horseshoes, and Hand Grenades ($19.99) This game isn’t on sale but it’s getting an advent calender with daily updates until christmas. This is basically the ultimate “labor of love” game in VR. Detailed physics simulation of lots of guns, big recommendation for those with any interest in sandbox, has game modes like Take and Hold and Team Fortress, single player only.
Pistol Whip (-20%, $19.99) This doesn’t go on sale as often. I would say it’s the first rhythm game that can actually go toe to toe with Beat Saber. It doesn’t have custom maps, but it gets regular content updates and just got a set of five campaign levels.
VTOL VR (-15% $25.49) This is the most advanced made for VR flight sim with full VR controls, tons of customization, and a bunch of modern fighter planes. It’s a community favorite and it’s even getting multiplayer soon.
AGOS - A Game Of Space (-33%, $20.09) This got a super mixed reaction. It’s basically a third person satellite simulator. If you like the movement method you’ll like the game, otherwise you probably won’t. Watch some gameplay on youtube.
Sairento (-35%, $19.79) This is like a ninja version of Superhot. I didn't enjoy it too much but many people like it. It has a lot of different weapons and you can do things like bounce off walls up to an enemy and cutting their head off with a katana.
Gnomes & Goblins (-35%, $19.49) This got a mixed reaction. Basically it’s a game where you visit a community of gnomes and has two parts. In the first part you go on a little adventure meeting the gnomes and hanging out with them. But the rest of the game is doing activities and collecting artifacts around their town to fill your house.
Disassembly VR (-30%, $20.99) Destruction and deconstruction physics sandbox simulator, just added melee combat.
Also worth taking a look at, over at Fanatical they’re doing a “make your own bundle.” 2 games for $6.99, 3 games for $9.99, 5 games for $14.99
Cosmic Trip - A very polished VR base capture RTS in first person where you build and manage drones and mine for crystals on an alien planet.
Sprint Vector - Basically a footrace game you play by swinging your arms, set on an alien gameshow.
Polybius - A trippy tunnel shooter with surreal pixel graphics, based on the haunted arcade game.
Rainbow Reactor- Kind of like a sac toss arcade puzzle game.
Conductor - An escape room style adventure game with a physics gun.
Battlewake - This was a really hyped game that kind of flopped. Basically it looks really great graphically but the gameplay loop feels really repetitive and kind of shallow. For co op at this price it's a good buy.
Raw Data - Early polished VR wave shooter, but it shows its age. It has multiplayer but the index support is pretty bad.
Dungeons & Treasure VR - A small voxel fantasy roguelike with multiplayer support.
Why do you dislike dogs!? - A complete guide and compilation
Hey everyone, Unfortunately, I do find myself often struggling to come up with a comprehensive list of elements which I dislike about dogs or dog worship when I am having a discussion. Therefore, I decided to compile of list of elements which I dislike or sentiments which are uttered by others who share a similar disdain/indifference. In that regard, I compiled some items which I have collected from various threads and would like for everyone to contribute if they feel like something is missing. Update: Added a disclaimer to clarify a few points due to some negative messages.
DISCLAIMER!
Some of these are highly subjective of course and your experience and opinion may differ. Not all of these elements represent my personal feelings. The following list provides an extensive selection of issues which are not necessarily applicable to every dog or owner. Thus, it is inevitable that some generalisations are included due to the broad variety of points. The content is offensive at times and strong adjectives with a negative connotation appear.
Dogs as a pet
The look and smell:
Dogs are aesthetically not pleasing and generally ugly. Some of course may look majestic but more often than not, they are hideous animals. Actually, some dogs look absolutely atrocious.
Dogs often convey a feeling of being lost and confused, which is heavily represented in their movement and facial expression. Thus making them look brainless and vacuous. In essence, dead soulless eyes constantly staring at you.
It is noticeable that dogs do tend to smell unpleasant or outright awful, this scent also often permeates through households in which dogs live. There are many reasons as to why dogs generally smell horrible.
Often the fur feels extremely greasy.
Dogs tend to lose a lot of fur and it sticks everywhere. Be it on furniture, clothes or areas which need to be hygienic such as a kitchen or bathroom.
A lot of dog breeds do slobber everywhere and leave a disgusting trace of their saliva on everything they touch.
The behavior:
Compared to other animals or pets, dogs have a very limited sense of hygiene. They are not naturally inclined to clean themselves compared to other animals (such as hamsters or cats). This results in the awful stench and unpleasant touch of the animal.
Dogs adore to spread their feces everywhere in order to mark their territory, be it in public spots or at home.
Dogs primarily use their mouths for every sort of interaction. They eat, greet and interact everything with their mouths. This is unpleasant considering that they also tend to eat feces and other trash, resulting in tons of bacteria and junk their mouth. Still they greet people or other dogs by licking them. Dogs cannot discern between unhygienic or unpleasant items, thus touching everything.
They are loud animals and tend to bark a lot, it does vary quite a bit but it can be universally accepted that dogs are loud and never cease to emit any sort of noise. Constant noises such as scampering, panting, huffing, licking, snoring, clawing or playing with objects.
Dogs seem almost unpredictable in their behavior and are after all a natural predator. They reactions are hard to identify as someone who is not familiar with the pet itself. Unfortunately, it is difficult to find the appropriate reaction considering that their behavior tends to vary so much.
Dogs are clumsy and lack refined movement, thus causing damage to the environment and overall appearing quite dumb.
Dogs are inherently obnoxious in their behavior, be it in terms of movement or noise. Especially compared to other animals and pets.
Dogs can be massive in terms of strength and speed, thus posing an actual threat to pets, people or children. They are offspring or designated natural predators and still rely on their instincts after all. Therefore, they can easily hurt people and there are not any meaningful options to stop them except for the application of violence. Even when violence should not be the last resort or encouraged.
Despite "extensive training" and "education", dogs seem especially hard to really keep under control (or owners are not capable of doing it). These pets can receive a ridiculous amount of training but still seem very unpredictable when confronted with elements that are new or different. Essentially, dog owners have trouble keeping their dog obedient. Even the best trained dogs require additional commands to keep them in check.
Dogs have not a notion of private space or distance. Most dogs rush off and invade the private space of individuals without any restraint. Going right into your private areas or jumping you. The unwanted touches and physical movement is extremely annoying, unpleasant and insulting. Even if you actively try to undermine such a behavior, they will still try to get your attention in any way possible.
Dogs tend to swirl around their owners or any person for that matter, for most of the time, still needing attention or constantly disturbing you while you are occupied (there are exceptions of course).
Dogs are highly dependent animals which solely rely on their master for nutrition and shelter. Most of the time, dogs are absolutely inept to live on their own. This results in the fact that dogs are simply very needful and require a ridiculous amount of attention. The maintenance and care is extremely demanding, dogs never truly learn to adopt more self-preservation approach. Thus solely relying on their owner. They never evolve beyond basic commands or behavior. Inability to be alone or to deal with not being the center of attention.
Dogs have very limited capabilities and there are no meaningful ways to interact with dogs. Just in very basic and simple ways.
In addition with the 2 above-mentioned factors, dogs are extremely plain and unintelligent creatures as a whole. Nevertheless, they are being perceived as smart and intelligent (point will be elaborated upon in another section). They will commit the same mistake again and do not learn from past experiences.
The "charactepersonality" of a dog is boring. It's just a mindless follower with no real realization or progression. Most dogs can simply be put into a category and stay static for all their life. Exempli gratia: "obnoxious and hyperactive", "lazy and boring" and so on.
Dogs are easily manipulated by offering food and thus very shallow.
Dog worship and owners
Dog culture:
Dogs being icons that are synonymous for loyalty, companionship and trust in western culture. Which is not representative of actual dogs which are mindless, easily manipulated and just generally follow the person who offers food and shelter.
Dogs being considered as universally "good" animals that have a high sense of morality and thus cannot be subject to criticism.
Equating dogs to humans when it comes to morality, emotions and cognitive processes.
Attributing important roles and duties to dogs which have more or less become obsolete in our current times or are simply not applicable in a regular everyday life situation. Such as police dogs, avalanche dogs or hunting dogs. These dogs have a purpose but a generic household has no need for such a dog but still equates the family dog to the standard of service animals.
The image that dog have always been Men's best friend which is fairly reductive in terms of thinking and perception. Many animals have been in service for human civilization but the dog always gets the spot as being loyal and caring.
The notion that a dog is the best compliment or addition to the image of a happy family.
If something is furry, small or clumsy; it is automatically cute. People immediately give in to dogs which appear cute and overlook everything else due to this fact. We all know the example "Aww, look how cute he looks his puppy eyes!"
The concept that dogs are inviolable of responsibility due to their status in our society, thus condemning everyone who is neutral or has a dislike for dogs. Equating those people to concepts such as "evil" or "bad" without any further research. They have an impenetrable exalted status.
Every person who is affiliated with dogs in one way or another is automatically deemed as great, caring and of higher moral superiority. This is especially applicable when it comes to dogs compared to other animals.
All the above-mentioned elements lead to a selective perception where the positive traits of dogs are massively blown out of proportion and the negative aspects are simply neglected or downplayed.
The sense of entitlement which results from the above-mentioned in dog owners or depiction of dogs as a whole. It leads to vilification of people who do not share the same sentiment (even to a casual extend) and causes a lot of conflicts which are not addressed. Dogs have caused tons of conflicts in the past.
Many people do fear dogs and the reasons are fairly valid, yet it's reduced to a childish fear with a smirk or is not acknowledged at all. It is a very condescending approach towards people with dog phobias.
The glorification of dogs in mediums such as movies, books and social medias. I cannot recount how many absolutely dumb and atrocious short clips I've seen about dogs being adopted and care for. People go absolutely nuts over these stories and it's plain dumb.
Dog owners/Fur parents/Dog lovers:
Owners who adopt dogs which they neglect right of the bat due to time or financial limits.
Owners who adopt dogs which are neglected out of boredom after a while
Owners who adopt a specific breed of dogs which are not suited to their lifestyle.
Owners who adopt dogs without having any prior knowledge or experience in keeping dogs. Furthermore, people who do not even bother to research about keeping a dog.
Owners who adopt dogs as a support animal to treat mental illnesses
Owners who adopt dogs from various third world countries which can be an extreme liability to the environment and people around.
Owners who adopt dogs and completely change their nature by treating them like children or in an overly luxurious fashion . For instance, carrying dogs in bags or giving them clothing. Bringing dogs to massage parlors and the like.
People who attribute the entire spectrum of human emotions and concepts to a dog. Essentially, talking to dogs like humans and applying human relationships to creatures which have a highly limited capability. Owners who "speak" for their dogs and how the dog is supposed to "feel".
Individuals who believe in mystified concepts about dogs that are taken straight out of some nonsensical beliefs such as:
-Dogs smell you fear -Dogs can sense your personality -Dogs are cleaner than humans -Dogs are utterly loyal and love their owner unconditionally -Dogs are protector and guardians
Everyone who equates dogs equally as important as humans and also on the same level.
A person who believes that dogs have real rights and are "people" with full cognitive, moral and sensible capabilities.
Putting dog ownership on the same level as being a real parent, equating the amount of responsibility for both situations.
Owners who desperately try to keep their dogs alive despite old age, sickness or major wounds. At times, putting a dog to rest is a wiser decision instead of clinging on to the life of an animal that is barely capable to live.
Owners who prefer to have a sort of slave/master relationship, craving unconditional love from an animal that has limited cognitive processes knowing that perhaps that this animal is the only way to deal with social issues or behavioral problems.
Owners with an incredible sense of entitlement and who believe that society should accommodate to the needs of their dogs without really reflecting as to why it might not be correct. Many dog owners have very selfish and narcistic tendencies which are reflected on a lot of factors such as these:
-Not putting dogs on a leash and thinking they can roam wherever they please. Dogs need to be put on a leash and are not suited for every environment. -Owners who take their dog with them to every location even if this is prohibited or unhygienic. -Branding people as sociopaths and emotionless for not liking their dogs or dogs in general. - Dog lovers who think that the life of their dog is more important than everything and everyone else. -Owners expect everyone to like their dogs or perceive it as the "best boy" compared to others -Prioritizing "dog rights" over any other sort of right.
Owners who center all their discussions around their dogs and dog culture in general. Everyone has been in that situation where a person could just not shut the fuck up about their dog and even if it's obvious that you have no interest. The person still thinks that you should display any sort of excitement of their pet.
Owners who have to suddenly rearrange their entire lives around the dog and the expectation that others do the same. Such as interior design or schedules.
Owners who hijack every discussion or conversation with their dog, trying to impose their pet on everyone else even if it's not relevant to the situation. (I follow a group on social media about beautiful landscapes of my home country, probably half of the submissions are blurry pics of dogs sitting in grass.)
Owners who create social media accounts of their dogs and seriously think that it would be that interesting to anyone, seeing another generic dog in the same kind of pictures that we have seen a million times.
Relationship problems which occur due to a difference in pet preference, I cannot recount how many times I have received negative feedback for expressing my feelings in a polite way regarding dogs.
Massive failure to realize that the behavior of a dog may be insanitary, annoying or offensive to a person
The fanaticism and sheer will to defend dogs as blindly as possible when a dog is depicted in a negative light. For instance during dog attacks (plenty of examples in this sub-reddit as well). I can barely recount how many times I have seen dog owners blaming everything and everyone else instead of the dog who caused damage
Owners who blame every external factor for their own failure or the failure of the dog in case of damage which might have occurred during an incident.
Owners who actively downplay, ignore or laugh about the awful behavior of their dog towards strangers. How many times have people excused the behavior with nonsensical arguments? How many times were you in an awful situation with a dog and was just deemed as "funny", "cute" or "harmless" by the owner?
Let dogs run free in parks and public places, thus resulting in dogs annoying everyone. Additionally, this is a major safety hazard when it comes to roads and traffic.
The fact that incidents where dogs are harmed, dogs always get a pass for everything, even if that said incident was caused by the dog in the first place.
Miscellaneous
Dogs have been bred and mutated for decades in order to create specific desirable character traits or look. This is a huge hypocrisy considering that some dogs are genetically modified to an extend where it is damaging the dog itself or you get insane mentally psyched dogs. It is absolutely unnatural and horrible, as a general concept and for dogs.
There are dogs breeds which are inherently more aggressive and violent as depicted on our chart in this sub-reddit FAQ thread. Breeds such as Pitbulls should not be bred nor be accessible for the public. These breeds are serious threat for people as seen by the countless incidents.
People are allergic to dogs and can have severe reactions which are harmful for their health.
Dogs wreak havoc upon local ecosystems by hunting animals and destroying plants and wildlife.
Dog littering is a serious issue in cities and many other places. Dog feces can be found anywhere and it's rare to see a dog owner taking responsibility for it. Many parks are covered in shit and the consequences are miniscule.
Anyway, I tried to keep them as tight as possible and not include to many examples because I would probably never finish. On a personal note, I am just tired of it. I had plenty of awful experiences in my life despite having an open mindset and trying to make dogs my friends. Either way, it always resulted in bullshit that I cannot stand for, then I get antagonized for disliking dog. Just sick of this crap.
When you put on the hazard suit in the game, it will play this music. It plays it at random times in the game. How do I change it? < > Showing 1-9 of 9 comments . Shard FloofFox. Dec 9, 2019 @ 4:55pm why the bloody hell, would you want to do something like that. #1. barney. Dec 10, 2019 @ 12:34pm Originally posted by byteau: I believe all you need to do is replace Half-Life12.mp3 located in Half-Life script April 12, 2004 All dialogue is copyright of Valve Entertainment. This document is copyright of Matthew Sullivan 2004. This guide was written for the GameFAQs website. It may not be reproduced, in whole or in part, on any other website without permission from the author. This guide may be used for private, non- commercial use only. The purpose of this guide is to lay out the 1. Start Half-life Using The Command Line "Hl.exe -console". You Can Now Access The Console Using The "~" Key. 2. Enter The Command "Sv_cheats 1" In The Console. Cheats Are Now Enabled. 3. Here's A Partial List Of Cheats. /impulse 101 /God - Godmode (Invincibility). /God 0 - Godmode off /Noclip - No Clipping (Walk Through Walls, Etc.) /notarget - Opponents The following is a list of quotes and sounds from the Hazardous Environment Suit in every Half-Life game.. The suit's sentences always start with various notification sounds whose pitches are sometimes changed by the game engine. They are not included in our sound files. Information found in Half-Life’s sentences.txt, transcripts partially based on the Half-Life 2 subtitles. Half-Life's aliens come in all shapes and sizes, but they do have one thing in common: they aren't stupid. They'll perform sophisticated threat assessments, recruit others of their kind, and That’s because HDTF is canon and Half-Life isn’t. level 2 . 9 points · 1 year ago. Spoilers, that was Mitch in a hazard suit the whole time. Continue this thread level 1. 7 points · 1 year ago. I always assumed he put it on but it just shows him without it for cover art so you can see his face. View Entire Discussion (11 Comments) More posts from the HalfLife community. 5.4k. Posted by 3 Gina's HEV Suit is tan colored. As suggested by the handwritten notes added by Gina in the Hazard Course Training schedule from the Half-Life PlayStation 2 instruction manual, her job as Hazardous Environment Supervisor probably involves supervising the Hazard Course trainings, among other things.She is also one of the several scientists to train other scientists in the Hazard Course. The Mark V Hazard Suit stored in Kleiner's Lab prior to Gordon's use.. In Half-Life 2, despite being allowed to keep it in the previous game, Freeman starts without the suit.After a visit to Dr. Isaac Kleiner, his former colleague from Black Mesa, Freeman receives an upgraded HEV suit, the Mark V. Go to the start menu, then go to all programs, then go to accessesories, then click on command prompt. Select you Half-Life directory and type hl.exe -console then Half-Life should open. Start a... The HEV suit designed and created for the Half-Life gaming series is undoubtedly an intelligent costume. With its healing and protecting abilities, the HEV suits serve more as a partner in the battle against Xen creatures than a mere highly optimized protective shield. The good news is at the end of Half-Life series, Freeman gets to keep the HEV suit as G-man allows him to keep it. Hazardous
Alyx Wants To Get In My Hazard Suit Half-Life 2 ...
This is my playthrough of the first Half-Life, with live commentary. Follow me on Twitter: http://twitter.com/#!/gabehype Add me on Facebook: http://www.face... Download:https://www.wasd.pro/uploads/fallout-4-half-life-2-hazmat-suit-weapons-mod/ Gordon is not impressed with Black Mesa's safety procedures.Starring Kyle Sullivan and Ethan GelinasCamera, etc. by Jon Currie and Ian Conn"Living Forever" b... I mean.....the suppression field is down, right? After that stalker train crash we have to find our way to the surface and that means traveling through some ... A badass moment in gaming history, and from a personal favourite game of mine too. :)Note to self: Video quality is blurry, will need to fix that in future v... Half-Life Walkthrough Part 1 Half-Life Walkthrough Part 1 W/CommentaryMy Walkthrough / Lets play of Half-Life Part 1 GameplayHalf-Life is a first-person shoo... Full Playthrough of Half-Life on the original GoldSrc Engine (Gold Source) with No deaths★★★ Please SUBSCRIBE, LIKE and SHARE ★★★ Thanks :)Join us on: Discor... In this part we finally get a HAZARD SUIT!! And get life finally :/ fun! Hello I am going to start a Half Life Series soon.